Iodometric measurement of lipid hydroperoxides in human plasma

Many assay techniques have been used to measure lipid hydroperoxides in plasma, including absorbance of conjugated dienes and reactivity with thiobarbituric acid. Because these measurements are not specific for lipid hydroperoxides, we modified an exisiting iodometric method to correct for interfering phenomena and to provide a more specific measurement of the lipid hydroperoxide content of plasma. To ensure reproducible extraction of hydroperoxides from the many possible forms in plasma, the plasma was treated to hydrolyze enzymatically cholesterol ester, triglycerides, and phospholipids, and the nonesterified fatty acid peroxides were then extracted with ethyl acetate. Extracted lipids were reacted with potassium iodide in acetic acid and methylene chloride, and the resulting triiodide ion (I3-) was measured spectrophotometrically. Correction for nonoxidizing chromophores was made after back-titration of the triiodide ion to iodide with sodium thiosulfate and other non-peroxide oxidants were estimated by their resistance to reduction with glutathione peroxidase. Recovery of added hydroperoxide standards provided routine validations of the procedure's efficiency. The method indicated that insignificant amounts of hydroperoxide may be in the less polar lipids, but the total amount of lipid hydroperoxide esterfied in the plasma lipids of apparently healthy humans may be as much as 4.0 +/- 1.7 microM.     

Selective microdetermination of lipid hydroperoxides

A sensitive and selective assay for lipid hydroperoxides was developed based upon the activation by hydroperoxides of the cyclooxygenase activity of prostaglandin H synthase. The assay measures hydroperoxides directly by their stimulatory action on the cyclooxygenase and thus differs from the methods used currently which rely on the measurement of secondary products to estimate the amount of hydroperoxide. The present assay of enzymatic response was approximately linear in the range 10 to 150 pmol of added lipid hydroperoxide. This sensitivity for lipid peroxides is about 50-fold greater than that of the thiobarbiturate assay with fluorescence detection. When applied to samples of human plasma, the enzymatic assay indicated that the concentration of lipid hydroperoxides in normal subjects is 0.5 microM, more than 50-fold lower than estimated by the thiobarbiturate assay (30-50 microM). Nevertheless, the circulating concentration of 0.5 microM lipid hydroperoxide approaches that reported to have deleterious effects upon vascular prostacyclin synthase.     

Lipid peroxidation and haemoglobin degradation in red blood cells exposed to t-butyl hydroperoxide. The relative roles of haem- and glutathione-dependent decomposition of t-butyl hydroperoxide and membrane lipid hydroperoxides in lipid peroxidation and haemolysis

Red cells exposed to t-butyl hydroperoxide undergo lipid peroxidation, haemoglobin degradation and hexose monophosphate-shunt stimulation. By using the lipid-soluble antioxidant 2,6-di-t-butyl-p-cresol, the relative contributions of t-butyl hydroperoxide and membrane lipid hydroperoxides to oxidative haemoglobin changes and hexose monophosphate-shunt stimulation were determined. About 90% of the haemoglobin changes and all of the hexose monophosphate-shunt stimulation were caused by t-butyl hydroperoxide. The remainder of the haemoglobin changes appeared to be due to reactions between haemoglobin and lipid hydroperoxides generated during membrane peroxidation. After exposure of red cells to t-butyl hydroperoxide, no lipid hydroperoxides were detected iodimetrically, whether or not glucose was present in the incubation. Concentrations of 2,6-di-t-butyl-p-cresol, which almost totally suppressed lipid peroxidation, significantly inhibited haemoglobin binding to the membrane but had no significant effect on hexose monophosphate shunt stimulation, suggesting that lipid hydroperoxides had been decomposed by a reaction with haem or haem-protein and not enzymically via glutathione peroxidase. The mechanisms of lipid peroxidation and haemoglobin oxidation and the protective role of glucose were also investigated. In time-course studies of red cells containing oxyhaemoglobin, methaemoglobin or carbonmono-oxyhaemoglobin incubated without glucose and exposed to t-butyl hydroperoxide, haemoglobin oxidation paralleled both lipid peroxidation and t-butyl hydroperoxide consumption. Lipid peroxidation ceased when all t-butyl hydroperoxide was consumed, indicating that it was not autocatalytic and was driven by initiation events followed by rapid propagation and termination of chain reactions and rapid non-enzymic decomposition of lipid hydroperoxides. Carbonmono-oxyhaemoglobin and oxyhaemoglobin were good promoters of peroxidation, whereas methaemoglobin relatively spared the membrane from peroxidation. The protective influence of glucose metabolism on the time course of t-butyl hydroperoxide-induced changes was greatest in carbonmono-oxyhaemoglobin-containing red cells followed in order by oxyhaemoglobin- and methaemoglobin-containing red cells. This is the reverse order of the reactivity of the hydroperoxide with haemoglobin, which is greatest with methaemoglobin. In studies exposing red cells to a wide range of t-butyl hydroperoxide concentrations, haemoglobin oxidation and lipid peroxidation did not occur until the cellular glutathione had been oxidized. The amount of lipid peroxidation per increment in added t-butyl hydroperoxide was greatest in red cells containing carbonmono-oxyhaemoglobin, followed in order by oxyhaemoglobin and methaemoglobin. Red cells containing oxyhaemoglobin and carbonmono-oxyhaemoglobin and exposed to increasing concentrations of t-butyl hydroperoxide became increasingly resistant to lipid peroxidation as methaemoglobin accumulated, supporting a relatively protective role for methaemoglobin. In the presence of glucose, higher levels of t-butyl hydroperoxide were required to induce lipid peroxidation and haemoglobin oxidation compared with incubations without glucose. Carbonmono-oxyhaemoglobin-containing red cells exposed to the highest levels of t-butyl hydroperoxide underwent haemolysis after a critical level of lipid peroxidation was reached. Inhibition of lipid peroxidation by 2,6-di-t-butyl-p-cresol below this critical level prevented haemolysis. Oxidative membrane damage appeared to be a more important determinant of haemolysis in vitro than haemoglobin degradation. The effects of various antioxidants and free-radical scavengers on lipid peroxidation in red cells or in ghosts plus methaemoglobin exposed to t-butyl hydroperoxide suggested that red-cell haemoglobin decomposed the hydroperoxide by a homolytic scission mechanism to t-butoxyl radicals.     

Detection of Picomole Levels in Lipid Hydroperoxides by a Chemiluminescence Assay

A highly sensitive and simple chemiluminescent method for the quantitation of lipid hydroperoxides at the picomole level is described. The method is based on detecting the chemiluminescence generated during the oxidation of luminol by the reaction with hydroperoxide and cytochrome c under mild conditions. A semilogarithmic relationship was observed between the hydroperoxide added and the chemiluminescence produced. For lipid hydroperoxides, cytochrome c was a most favorable catalyst for generating the chemiluminescence, rather than cytochrome c heme peptide and horseradish peroxidase. This method had high sensitivity to methyl linoleate hydroperoxide, arachidonic acid hydroperoxide and cholesterol hydroperoxide, but low to /-butyl hydroperoxide, J-butyl perbenzoate, diacyl peroxides (lauroyl peroxode and benzoyl peroxide) and dialkyl peroxides (di-/-butyl peroxide and dicumyl peroxide).     

Theoretical analysis of a site-specific chemiluminescence reaction and its application to quantitation of lipid hydroperoxides

A system was designed for chemiluminescent measurement of lipid hydroperoxides by their site-specific reaction in sodium dodecylsulfate micelles. Ferrous ion-induced decomposition of lipid hydroperoxides in the sodium dodecylsulfate micelles resulted in strong chemiluminescence of the Cypridina luciferin analog, 2-methyl-6-phenyl-3,7-dihydroimidazo[1,2-alpha]pyrazin-3-one (CLA). After addition of ferrous sulfate to the micelles containing lipid hydroperoxide and luciferin, the chemiluminescence intensity reached a maximum rapidly and then decreased. The sequence of this reaction was elucidated by theoretical analysis, which demonstrated that the maximum chemiluminescence intensity is proportional to the initial concentration of hydroperoxide. Good linear relationships were observed between the maximum counts of chemiluminescence and the amounts of hydroperoxides of linoleic acid, phosphatidylcholine, choresterol (5 alpha), cumene and tert-butyl and hydrogen peroxide. This chemiluminescence method was simple and sensitive enough to detect picomole levels of linoleic acid and phosphatidylcholine hydroperoxides.     

Development of novel fluorescent probe 3-perylene diphenylphosphine for determination of lipid hydroperoxide with fluorescent image analysis

A novel fluorescent probe 3-perylene diphenylphosphine (3-PeDPP) was synthesized for the direct analysis of lipid hydroperoxides. The structure of 3-PeDPP was identified by the spectroscopic data, FAB-MS, (1)H NMR, and (13)C NMR. The reactivities of 3-PeDPP with lipid hydroperoxides were investigated in chloroform/MeOH homogeneous solutions and PC liposome model systems oxidized by either 2,2'-azobis(2-amidinopropane)dihydrochloride and photosensitized oxidation. The fluorescence intensity derived from 3-perylene diphenylphosphineoxide (3-PeDPPO) increased proportionally with amount of hydroperoxides produced in homogeneous solutions and liposome model systems. 3-PeDPP was easily incorporated into mouse myeloma SP2 cells and thin tissue section for dynamic membrane lipid peroxidation studies. Linear correlations between fluorescence intensity and amount of hydroperoxides in the cell membrane and tissue sections were obtained. The fluorescence intensity from 2-dimensional image analysis was also well correlated with lipid hydroperoxide level in these models. Thus, the novel probe 3-PeDPP is useful for the direct determination of lipid hydroperoxides in biological materials.     

Photooxidation of cell membranes in the presence of hematoporphyrin derivative: reactivity of phospholipid and cholesterol hydroperoxides with glutathione peroxidase

The susceptibility of photodynamically-generated lipid hydroperoxides to reductive inactivation by glutathione peroxidase (GPX) has been investigated, using hematoporphyrin derivative as a photosensitizing agent and the human erythrocyte ghost as a target membrane. Photoperoxidized ghosts were reactive in a glutathione peroxidase/reductase (GPX/GRD)-coupled assay only after phospholipid hydrolysis by phospholipase A2 (PLA2). However, enzymatically determined lipid hydroperoxide values were consistently approx. 40% lower than iodometrically determined values throughout the course of photooxidation. Moreover, when irradiated ghosts were analyzed iodometrically during PLA2/GSH/GPX treatment, a residual 30-40% of non-reactive lipid hydroperoxide was observed. The possibility that cholesterol product(s) account for the non-reactive lipid hydroperoxide was examined by tracking cholesterol hydroperoxides in [14C]cholesterol-labeled ghosts. The sum of cholesterol hydroperoxides and GPX/GRD-detectable lipid hydroperoxides was found to agree closely with iodometrically determined lipid hydroperoxide throughout the course of irradiation. Thin-layer chromatography of total lipid extracts indicated that cholesterol hydroperoxide was unaffected by PLA2/GSH/GPX treatment, whereas most of the phospholipid peroxides were completely hydrolyzed and the released fatty acid peroxides were reduced to alcohols. It appears, therefore, that the GPX-resistant lipid hydroperoxides in photooxidized ghosts were derived primarily from cholesterol. Ascorbate plus Fe3+ produced a burst of free-radical lipid peroxidation in photooxidized, PLA2-treated ghosts. As expected for fatty acid hydroperoxide inactivation, the lipid peroxidation was inhibited by GSH/GPX, but only partially so, suggesting that cholesterol hydroperoxide-derived radicals play a major role in the reaction.     

Highly Sensitive Flow Injection Analysis of Lipid Hydroperoxides in Foodstuffs

Lipid hydroperoxides in oils and foods were measured by a flow injection analysis system with high sensitivity and selectivity. After sample injection, lipid hydroperoxides were reacted with diphenyl-1-pyrenylphosphine (DPPP) in a stainless steel coil, then the fluorescence intensity of DPPP oxide, that was produced by the reaction, was monitored. By this method, trilinolein hydroperoxide showed good linearity between 0.4 and 79pmol and their detection limits were 0.2pmol (signal-to-noise ratio = 3). The method made it possible to inject samples at 2-min intervals. There was a good agreement of the amounts of lipid hydroperoxides in oils and foods between by the batch method with DPPP and by the proposed method (coefficient of correlation: r = 0.999; n = 21; peroxide value = 0.09–167 meq/g). With this method, the calibration graph of trilinolein hydroperoxide was useful for all samples tested.     

The role of selenium peroxidases in the protection against oxidative damage of membranes

The present review deals with the chemical properties of selenium in relation to its antioxidant properties and its reactivity in biological systems. The interaction of selenite with thiols and glutathione and the reactivity of selenocompounds with hydroperoxides are described. After a short survey on distribution, metabolism and organification of selenium, the role of this element as a component of the two seleno-dependent glutathione peroxidases is described. The main features of glutathione peroxidase and phospholipid hydroperoxide glutathione peroxidase are also reviewed. Both enzymes reduce different hydroperoxides to the corresponding alcohols and the major difference is the reduction of lipid hydroperoxides in membrane matrix catalyzed only by the phospholipid hydroperoxide glutathione peroxidase. However, in spite of the different specificity for the peroxidic substrates, the kinetic mechanism of both glutathione peroxidase and phospholipid hydroperoxide glutathione peroxidase seems identical and proceeds through a tert-uni ping pong mechanism. In the reaction cycle, indeed, as supported by the kinetic data, the oxidation of the ionized selenol by the hydroperoxide yields a selenenic acid that in turn is reduced back by two reactions with reduced glutathione. Special emphasis has been given to the role of selenium-dependent glutathione peroxidases in the prevention of membrane lipid peroxidation. While glutathione peroxidase is able to reduce hydrogen peroxide and other hydroperoxides possibly present in the soluble compartment of the cell, this enzyme fails to inhibit microsomal lipid peroxidation induced by NADPH or ascorbate and iron complexes. On the other hand, phospholipid hydroperoxide glutathione peroxidase, by reducing the phospholipid hydroperoxides in the membranes, actively prevents lipid peroxidation, provided a normal content of vitamin E is present in the membranes. In fact, by preventing the free radical generation from lipid hydroperoxides, phospholipid hydroperoxide glutathione peroxidase decreases the vitamin E requirement necessary to inhibit lipid peroxidation. Finally, the possible regulatory role of the selenoperoxidases on the arachidonic acid cascade enzymes (cyclooxygenase and lipoxygenase) is discussed.     

Increase of Lipid Hydroperoxides in Tissues of Vitamin E-Deficient Rats

The level of lipid hydroperoxides was determined by a newly developed method in rat tissues of vitamin E deficiency, which was a good in viuo model of enhanced radical reactions. In the heart, lung and kidney, the level of lipid hydroperoxides increased significantly as early as 4 weeks after feeding on a tocopherol-deficient diet compared with that of the control group. After 8 weeks of the deficiency, similar results were obtained. These results indicate that the lipid hydroperoxide is available as an extremely sensitive indicator of lipid peroxidation in these organs, because it takes several months to detect manifestations of the vitamin deficiency based on conventional indices.     

Chemiluminescent assay of lipid hydroperoxides

The addition of luminol plus a catalyst such as peroxidase or a heme prosthetic group to a solution containing a small quantity of lipid hydroperoxides results in a flash of chemiluminescence, the intensity of which is a function of the hydroperoxide concentrations. Various protocols for lipid hydroperoxide assays have been described and we have studied conditions to increase their sensitivity and specificity. Plasma lipid hydroperoxide determinations require an extraction, since compounds present in plasma interfere with light emission. Moreover, the sensitivity of the assay is by the presence of hydrogen peroxide in the medium, which causes high background values. Catalase does not act on lipid hydroperoxides and can be used to eliminate hydrogen peroxide from the reaction medium. The determination requires a blank tube in which hydroperoxides are destroyed by incubating the sample with haematin plus ascorbate. The increase in the chemiluminescence of the assay tube caused by the presence of lipid hydroperoxides is then compared to the value obtained for an internal standard.     

Fluorescence formation from the interaction of DNA with lipid oxidation degradation products

To clarify the mechanism of fluorescence formation between DNA and lipid degradation products in the presence of ferric chloride and ascorbic acid, a number of carbonyl compounds and decomposition products of pure methyl linolenate hydroperoxides were examined. Keto derivatives of methyl ricinoleate, linoleate, and oleate, alkanals and 2-alkenals produced little or no fluorescence with DNA in the presence of ferric chloride-ascorbic acid. 2,4-Alkadienals were more active and 2,4,7-decatrienal was the most active. Mixtures of volatile aldehydes prepared from linolenate hydroperoxide decomposed either thermally or with iron and ascorbate had the same activity as 2,4,7-decatrienal. Higher molecular-weight products from the decomposition of methyl linolenate hydroperoxides showed relatively low activity. beta-Carotene, alpha-tocopherol and other antioxidants effectively reduced the amount of fluorescence formed by linolenate hydroperoxides. The results suggest that, in addition to hydroperoxide decomposition products, singlet oxygen and/or free radical species contribute significantly to the fluorescence formed from the interaction of methyl linolenate hydroperoxides with DNA in the presence of ferric chloride and ascorbic acid.     

Peroxidation stimulated by lipid hydroperoxides on bovine retinal pigment epithelium mitochondria: effect of cellular retinol-binding protein

This study analyzes the effect of cellular retinol-binding protein (CRBP), partially purified from retinal pigment epithelium (RPE) cytosol, on the non-enzymatic lipid peroxidation induced by fatty acid hydroperoxides of mitochondrial membranes isolated from bovine RPE. The effect of different amounts (50, 75 and 100 nmol) of linoleic acid hydroperoxide (LHP), arachidonic acid hydroperoxide (AHP) and docosahexaenoic acid hydroperoxide (DHP) on the lipid peroxidation of RPE mitochondria was studied; RPE mitochondria deprived of exogenously added hydroperoxide was utilized as control. The process was measured simultaneously by determining chemiluminescence as well as polyunsaturated fatty acid (PUFA) degradation of total lipids isolated from RPE mitochondria. The addition of hydroperoxides to RPE mitochondria produces a marked increase in light emission that was hydroperoxide concentration dependent. The highest value of activation was produced by LHP. The major difference in the fatty acid composition of total lipids isolated from native and peroxidized RPE mitochondria incubated with and without hydroperoxides was found in the docosahexaenoic acid content, this decreased 40.90+/-3.01% in the peroxidized group compared to native RPE mitochondria. The decrease was significantly high: 86.32+/-2.57% when the lipid peroxidation was stimulated by 100 nmol of LHP. Inhibition of lipid peroxidation (decrease of chemiluminescence) was observed with the addition of increasing amounts (100-600 microg) of CRBP to RPE mitochondria. The inhibitory effect reaches the highest values in the presence of LHP.     

Detection and characterization of lipid hydroperoxides at picomole levels by high-performance liquid chromatography

A new method for the detection of various lipid hydroperoxides and hydrogen peroxide at the picomole level has been developed by combining an HPLC system with an ultrasensitive analytical system based on the detection of chemiluminescence emitted by isoluminol in the presence of hydroperoxide and microperoxidase. This HPLC separation removes interfering antioxidants so that the method can be applied to biological samples such as blood plasma lipids. Several HPLC conditions are described which allow simple identification of different lipid hydroperoxides.     

Reduction of lipid hydroperoxides by apolipoprotein B-100.

We have previously isolated two proteins which can reduce phosphatidylcholine hydroperoxide (PC-OOH) from human blood plasma and identified one of the proteins as apolipoprotein A-I (Mashima, R. , et al. (1998) J. Lipid Res. 39, 1133-1140). In the present study we have identified the other protein as apolipoprotein B-100 (apo B-100) by amino acid sequence analysis of its tryptic peptides. The reactivity of lipid hydroperoxides with apo B-100 decreased in the order of PC-OOH > linoleic acid hydroperoxide > cholesteryl ester hydroperoxide under our experimental conditions. Pretreatment of apo B-100 with chloramine T, an oxidant of methionine, diminished the PC-OOH-reducing activity, indicating that some of 78 methionines are responsible for the reduction of PC-OOH. Despite the presence of 6 methionines in albumin, albumin was inactive to reduce PC-OOH. Free methionine was also inactive. These data suggest that the accessibility and binding of lipid hydroperoxides to the protein methionine residues are crucial for reduction of lipid hydroperoxides.     

Protein hydroperoxides are a major product of low density lipoprotein oxidation during copper, peroxyl radical and macrophage-mediated oxidation

Damage to apoB100 on low density lipoprotein (LDL) has usually been described in terms of lipid aldehyde derivatisation or fragmentation. Using a modified FOX assay, protein hydroperoxides were found to form at relatively high concentrations on apoB100 during copper, 2,2'-azobis(amidinopropane) dihydrochloride (AAPH) generated peroxyl radical and cell-mediated LDL oxidation. Protein hydroperoxide formation was tightly coupled to lipid oxidation during both copper and AAPH-mediated oxidation. The protein hydroperoxide formation was inhibited by lipid soluble alpha-tocopherol and the water soluble antioxidant, 7,8-dihydroneopterin. Kinetic analysis of the inhibition strongly suggests protein hydroperoxides are formed by a lipid-derived radical generated in the lipid phase of the LDL particle during both copper and AAPH mediated oxidation. Macrophage-like THP-1 cells were found to generate significant protein hydroperoxides during cell-mediated LDL oxidation, suggesting protein hydroperoxides may form in vivo within atherosclerotic plaques. In contrast to protein hydroperoxide formation, the oxidation of tyrosine to protein bound 3,4-dihydroxyphenylalanine (PB-DOPA) or dityrosine was found to be a relatively minor reaction. Dityrosine formation was only observed on LDL in the presence of both copper and hydrogen peroxide. The PB-DOPA formation appeared to be independent of lipid peroxidation during copper oxidation but tightly associated during AAPH-mediated LDL oxidation.     

Hematin- and peroxide-catalyzed peroxidation of phospholipid liposomes

The effect of hydroperoxides on hematin-catalyzed initiation and propagation of lipid peroxidation was examined utilizing soybean phosphatidylcholine liposomes as model membranes. Polarographic and spectrophotometric methods revealed a bimodal pseudocatalytic activity for hematin. A slow initiation phase of peroxidation was observed in the presence of low peroxide concentrations, whereas a fast propagative phase was observed at higher peroxide levels. Peroxide levels were manipulated enzymatically by the combination of phospholipase A2 and lipoxidase or by the direct addition of linoleic acid hydroperoxide, cumene hydroperoxide, or hydrogen peroxide. In addition, the effect of two different techniques for liposome preparation, i.e., sonication and extrusion, were compared on the basis of peroxidation kinetics. High pressure liquid chromatography analysis showed that sonicated liposomes contained higher levels of endogenous peroxides than the extruded ones. These sonicated liposomes also exhibited more rapid peroxidation following hematin addition. Extruded liposomes were more resistant to hematin-catalyzed peroxidation but became better substrates when exogenous hydroperoxides were added. All three peroxides reacted with hematin during which decomposition of peroxide and irreversible oxidation of hematin took place. Spectral analysis of hematin indicated that a higher oxidation state of hematin iron may be transiently formed during reaction with hydroperoxides and accounts for the propagation of lipid peroxidation when reactions proceed in the presence of soybean phosphatidylcholine liposomes. Of the three peroxides studied, linoleic acid hydroperoxide was most efficient in supporting hematin-catalyzed lipid peroxidation. The relevance of our findings is discussed in terms of the concentration dependence for lipid peroxides in determining the rate and extent of radical propagation chain reactions catalyzed by heme-iron catalysts such as hematin. Variation of hematin and linoleic hydroperoxide concentrations may provide an efficient and reproducible method for inducing and manipulating the rates and extent of lipid peroxidation through facilitation of the propagative phase of lipid peroxidation. In addition, we address a problem inherent to in vitro studies of heme-catalyzed lipid peroxidation where preparations of peroxide-free membranes should be of concern.     

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.     

Enhancement of hydroperoxide-dependent lipid peroxidation in rat liver microsomes by ascorbic acid

Simultaneous addition of ascorbic acid and organic hydroperoxides to rat liver microsomes resulted in enhanced lipid peroxidation (approximately threefold) relative to incubation of organic hydroperoxides with microsomes alone. No lipid peroxidation was evident in incubations of ascorbate alone with microsomes. The stimulatory effect of ascorbate on linoleic acid hydroperoxide (LAHP)-dependent peroxidation was evident at all times whereas stimulation of cumene hydroperoxide (CHP)-dependent peroxidation occurred after a lag phase of up to 20 min. EDTA did not inhibit CHP-dependent lipid peroxidation but completely abolished ascorbate enhancement of lipid peroxidation. Likewise, EDTA did not significantly inhibit peroxidation by LAHP but dramatically reduced ascorbate enhancement of lipid peroxidation. The results reveal a synergistic prooxidant effect of ascorbic acid on hydroperoxide-dependent lipid peroxidation. The inhibitory effect of EDTA on enhanced peroxidation suggests a possible role for endogenous metals mobilized by hydroperoxide-dependent oxidations of microsomal components.