FISH studies reveal the molecular and chromosomal organization of individual telomere domains in tomato

The molecular and cytological organization of the telomeric repeat (TR) and the subtelomeric repeat (TGR1) of tomato were investigated by fluorescence in situ hybridization (FISH) techniques. Hybridization signals on extended DNA fibres, visualized as linear fluorescent arrays representing individual telomeres, unequivocally demonstrated the molecular co-linear arrangement of both repeats. The majority of the telomeres consisted of a TR and a TGR1 region separated by a spacer. Microscopic measurements of the TR and TGR1 signals revealed high variation in length of both repeats, with maximum sizes of 223 and 1330 kb, respectively. A total of 27 different combinations of TR and TGR1 was detected, suggesting that all chromosome ends have their own unique telomere organization. The fluorescent tracks on the extended DNA fibres were subdivided into four classes: (i) TR–spacer–TGR1; (ii) TR–TGR1; (iii) only TR; (iv) only TGR1. FISH to pachytene chromosomes enabled some of the TR/TGR1 groups to be assigned to specific chromosome ends and to interstitial regions. These signals also provided evidence for a reversed order of the TR and TGR1 sites at the native chromosome ends, suggesting a backfolding telomere structure with the TGR1 repeats occupying the most terminal position of the chromosomes. The FISH signals on diakinesis chromosomes revealed that distal euchromatin areas and flanking telomeric heterochromatin remained highly decondensed around the chiasmata in the euchromatic chromosome areas. The rationale for the occurrence and distribution of the TR and TGR1 repeats on the tomato chromosomes are discussed.     

Finding of novel telomeric repeats and their distribution in the human genome

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats “CACAGA” and “TCTCTGCGCCTGCGCCGGCGCGGCGCGCC” and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.     

Distribution of telomeric (TTAGGG)<Subscript>n</Subscript> sequences in avian chromosomes

The physical ends of mammalian and other vertebrate chromosomes consist of tandemly repeated (TTAGGG)(n) hexamers, nucleating a specialized telomeric structure. However, (TTAGGG)(n) sequences can also occur at non-telomeric sites, providing important insights into karyotypic evolution. By fluorescence in situ hybridization (FISH) we studied the chromosomal distribution of (TTAGGG)(n) sequences in 16 bird species, representing seven different orders. Many species, in particular the ratites, display (TTAGGG)(n) hybridization signals in interstitial and centromeric regions of their macrochromosomes in addition to the typical telomeric signals. In some but not all species these non-telomeric sites coincide with C-band-positive heterochromatin. The retention and/or amplification of telomeric (TTAGGG)(n) repeats at interstitial and centromeric sites may indicate the fusion of ancestral chromosomes. Compared with the macrochromosomes, the microchromosomes of most species are enriched with (TTAGGG)(n) sequences, displaying heterogeneous hybridization patterns. We propose that this high density of (TTAGGG)(n) repeats contributes to the exceptionally high meiotic recombination rate of avian microchromosomes.     

The number of vertebrate repeats can be regulated at yeast telomeres by Rap1-independent mechanisms

The number of telomeric DNA repeats at chromosome ends is maintained around a mean value by a dynamic balance between elongation and shortening. In particular, proteins binding along the duplex part of telomeric DNA set the number of repeats by progressively limiting telomere growth. The paradigm of this counting mechanism is the Rap1 protein in Saccharomyces cerevisiae. We demonstrate here that a Rap1-independent mechanism regulates the number of yeast telomeric repeats (TG(1-3)) and of vertebrate repeats (T(2)AG(3)) when TEL1, a yeast ortholog of the human gene encoding the ATM kinase, is inactivated. In addition, we show that a T(2)AG(3)-only telomere can be formed and maintained in humanized yeast cells carrying a template mutation of the gene encoding the telomerase RNA, which leads to the synthesis of vertebrate instead of yeast repeats. Genetic and biochemical evidences indicate that this telomere is regulated in a Rap1-independent manner, both in TEL1 and in tel1Delta humanized yeast cells. Altogether, these findings shed light on multiple repeat-counting mechanisms, which may share critical features between lower and higher eukaryotes.     

Conservation and characterization of unique porcine interstitial telomeric sequences

Telomeres are composed of TTAGGG repeats and located at the ends of chromosomes. Telomeres protect chromosomes from instability in mammals, including mice and humans. Repetitive TTAGGG sequences are also found at intrachromosomal sites, where they are named as interstitial telomeric sequences (ITSs). Aberrant ITSs are implicated in chromosomal instability and found in cancer cells. Interestingly, in pigs, vertebrate telomere sequences TTAGGG (vITSs) are also localized at the centromeric region of chromosome 6, in addition to the end of all chromosomes. Surprisingly, we found that botanic telomere sequences, TTTAGGG (bITSs), also localize with vITSs at the centromeric regions of pig chromosome 6 using telomere fluorescence in situ hybridization (FISH) and by comparisons between several species. Furthermore, the average lengths of vITSs are highly correlated with those of the terminal telomeres (TTS). Also, pig ITSs show a high incidence of telomere doublets, suggesting that pig ITSs might be unstable and dynamic. Together, our results show that pig cells maintain the conserved telomere sequences that are found at the ITSs from of plants and other vertebrates. Further understanding of the function and regulation of pig ITSs may provide new clues for evolution and chromosomal instability.     

Telomere dysfunction and chromosome instability

The ends of chromosomes are composed of a short repeat sequence and associated proteins that together form a cap, called a telomere, that keeps the ends from appearing as double-strand breaks (DSBs) and prevents chromosome fusion. The loss of telomeric repeat sequences or deficiencies in telomeric proteins can result in chromosome fusion and lead to chromosome instability. The similarity between chromosome rearrangements resulting from telomere loss and those found in cancer cells implicates telomere loss as an important mechanism for the chromosome instability contributing to human cancer. Telomere loss in cancer cells can occur through gradual shortening due to insufficient telomerase, the protein that maintains telomeres. However, cancer cells often have a high rate of spontaneous telomere loss despite the expression of telomerase, which has been proposed to result from a combination of oncogene-mediated replication stress and a deficiency in DSB repair in telomeric regions. Chromosome fusion in mammalian cells primarily involves nonhomologous end joining (NHEJ), which is the major form of DSB repair. Chromosome fusion initiates chromosome instability involving breakage-fusion-bridge (B/F/B) cycles, in which dicentric chromosomes form bridges and break as the cell attempts to divide, repeating the process in subsequent cell cycles. Fusion between sister chromatids results in large inverted repeats on the end of the chromosome, which amplify further following additional B/F/B cycles. B/F/B cycles continue until the chromosome acquires a new telomere, most often by translocation of the end of another chromosome. The instability is not confined to a chromosome that loses its telomere, because the instability is transferred to the chromosome donating a translocation. Moreover, the amplified regions are unstable and form extrachromosomal DNA that can reintegrate at new locations. Knowledge concerning the factors promoting telomere loss and its consequences is therefore important for understanding chromosome instability in human cancer.     

Interstitial telomeric repeats as markers of evolutionary changes in the mammalian karyotype: Human chromosome 2

The presence of conserved telomeric repeats represented by the hexamer (TTAGGG)_n at the chromosomal termini is necessary for the correct functioning and stability of chromosomes. A number of the genomes of mammals, including human, are known to contain interstitial telomeric sequences located far from the chromosomal termini. It is assumed that these repeats mark the regions of fusions or other rear-rangements of ancestral chromosomes. Exact localization of all interstitial telomeric sequences in the genome could significantly advance the understanding of the mechanisms of karyotype evolution and speciation. In this context, software was developed to search for degenerate interstitial telomeric repeats in complete sequences of mammalian chromosomes. The evolutionary significance of such repeats was demonstrated by the example of human chromosome 2. The results are available at http://www.bionet.nsc.ru/labs/theorylabmain/orlov/telomere/.     

Chromosome termini of the monocot plant Othocallis siberica are maintained by telomerase, which specifically synthesises vertebrate-type telomere sequences

Lack of Arabidopsis-type T3AG3 telomere sequences has recently been reported for the majority of investigated taxa of the monocot order Asparagales. In order to investigate this phenomenon in more detail, we conducted extensive cytogenetic and molecular analyses of the telomeres in Othocallis siberica, a member of this order. Terminal restriction fragment analysis together with Bal31 exonuclease assay showed that chromosome termini in O. siberica are formed by long stretches (more than 10 kbp) of vertebrate-type T2AG3 repeats. In addition, telomerase activity specifically synthesising (T2AG3)n sequence was detected in O. siberica protein extracts by telomerase repeat amplification protocol (TRAP). Fluorescence in situ hybridisation (FISH) revealed the presence of the vertebrate-type T2AG3 telomere sequences at all chromosome termini and at a few additional regions of O. siberica chromosomes, whereas Arabidopsis-type T3AG3 DNA and peptide nucleic acid (PNA) probes did not hybridise to chromosomes of Othocallis, except for polymorphic blocks in chromosomes 2 (interstitial) and 4 (terminal). These interstitial/terminal regions are apparently composed of large blocks of (T2AG3)n and (T3AG3)n DNA and represent a unique example of interspersion of two types of telomeric repeats within one genome. This may be a reflection of the recent evolutionary switch from Arabidopsis- to vertebrate-type telomeric repeats in this plant group.     

Telomere and 45S rDNA sequences are structurally linked on the chromosomes in <Emphasis Type="Italic">Chrysanthemum segetum</Emphasis> L.

Some reports have shown that nucleolar organizer regions are located at the telomeric region and have a structural connection with telomeres at the cellular level in many organisms. In this study, we found that all 45S ribosomal DNA (rDNA) signals were located at telomeric regions on the chromosomes in Chrysanthemum segetum L., and the 45S rDNA showed distinct signal patterns on different metaphase chromosome spreads. The bicolor fluorescence in situ hybridization experiment on the extended fibers revealed that telomere repeats were structurally connected with or interspersed into rDNA sequences. The close cytological structure relation between rDNA and telomere sequences led us to use PCR with combinations of the telomere primer and the rDNA primer to obtain some fragments, which were flanked by different rDNA and telomere primer sequences. One representative clone CHS2 contains closely connected rDNA and telomere sequences, suggesting that the telomere sequence invaded into the conserved rDNA sequence. In addition, the sequences of some PCR clones were flanked by the single telomeric primer sequence or the rDNA primer sequence. These results suggested that homologous recombination occurred between tandem repeat units of rDNA sequences or telomere repeats at the chromosome terminus.     

Interactions of TLC1 (Which Encodes the RNA Subunit of Telomerase), TEL1, and MEC1 in Regulating Telomere Length in the Yeast Saccharomyces cerevisiae

In the yeast Saccharomyces cerevisiae, chromosomes terminate with a repetitive sequence [poly(TG(1-3))] 350 to 500 bp in length. Strains with a mutation of TEL1, a homolog of the human gene (ATM) mutated in patients with ataxia telangiectasia, have short but stable telomeric repeats. Mutations of TLC1 (encoding the RNA subunit of telomerase) result in strains that have continually shortening telomeres and a gradual loss of cell viability; survivors of senescence arise as a consequence of a Rad52p-dependent recombination events that amplify telomeric and subtelomeric repeats. We show that a mutation in MEC1 (a gene related in sequence to TEL1 and ATM) reduces telomere length and that tel1 mec1 double mutant strains have a senescent phenotype similar to that found in tlc1 strains. As observed in tlc1 strains, survivors of senescence in the tel1 mec1 strains occur by a Rad52p-dependent amplification of telomeric and subtelomeric repeats. In addition, we find that strains with both tel1 and tlc1 mutations have a delayed loss of cell viability compared to strains with the single tlc1 mutation. This result argues that the role of Tel1p in telomere maintenance is not solely a direct activation of telomerase.     

Intrachromosomal location of the telomeric repeat (TTAGGG)n

Eukaryotic telomeres are specialized DNA-protein structures that are thought to ensure chromosomal stability and complete replication of the chromosome ends. All telomeres which have been studied consist of a tandem array of G-rich repeats which seem to be sufficient for telomere function. Originally, the human telomeric repeat (TTAGGG)_n was assumed to be exclusively located at the very end of all human chromosomes. More recent evidence, however, suggests an extension into proterminal regions. Very little is known about the interstitial distribution of telomeric repeats. Here we present evidence for the presence of (TTAGGG)_n repeats in internal loci on the long and short arms of different human chromosomes. In addition, we studied the genomic organization of these repeats in more detail and discuss possible functions of interstitial telomeric repeats in the human genome.     

Factors that influence telomeric oxidative base damage and repair by DNA glycosylase OGG1

Telomeres are nucleoprotein complexes at the ends of linear chromosomes in eukaryotes, and are essential in preventing chromosome termini from being recognized as broken DNA ends. Telomere shortening has been linked to cellular senescence and human aging, with oxidative stress as a major contributing factor. 7,8-Dihydro-8-oxogaunine (8-oxodG) is one of the most abundant oxidative guanine lesions, and 8-oxoguanine DNA glycosylase (OGG1) is involved in its removal. In this study, we examined if telomeric DNA is particularly susceptible to oxidative base damage and if telomere-specific factors affect the incision of oxidized guanines by OGG1. We demonstrated that telomeric TTAGGG repeats were more prone to oxidative base damage and repaired less efficiently than non-telomeric TG repeats in vivo. We also showed that the 8-oxodG-incision activity of OGG1 is similar in telomeric and non-telomeric double-stranded substrates. In addition, telomere repeat binding factors TRF1 and TRF2 do not impair OGG1 incision activity. Yet, 8-oxodG in some telomere structures (e.g., fork-opening, 3'-overhang, and D-loop) were less effectively excised by OGG1, depending upon its position in these substrates. Collectively, our data indicate that the sequence context of telomere repeats and certain telomere configurations may contribute to telomere vulnerability to oxidative DNA damage processing.     

New telomere formation after developmentally regulated chromosomal breakage during the process of chromatin diminution in Ascaris lumbricoides

During the process of chromatin diminution, which takes place in all presomatic cells of the early Ascaris embryo, the heterochromatic termini of the chromosomes are lost. Here we show that the newly formed ends of the reduced somatic chromosomes carry tandem repeats of the telomeric sequence TTAGGC. Comparison of a cloned somatic telomere with the corresponding germline chromosomal region revealed that these telomeric repeats are not present at or near the chromosomal breakage site. They are most likely added by a telomerase-mediated event. Chromosomal breakage, which precedes the telomere addition process, takes place within a short, specific chromosomal region (CBR); however, it does not occur at a single locus, but rather at many different sites. Altogether, our data show that chromatin diminution in Ascaris is a complex molecular process that includes site-specific chromosomal breakage, new telomere formation, and DNA degradation.     

Terminal regions of mammal chromosomes: Plasticity and role in evolution

The review considers data on the composition, organization, and functional significance of terminal regions in mammalian chromosomes, including telomeres and subtelomeric regions. Because of specific structure, features of DNA replication, and characteristic localization in somatic and meiotic cells, these regions are hot spots for many events associated with genome functioning in mammals. Instability of these regions is of special interest. Evidence suggesting that instability of chromosomal regions containing telomeric DNA is a factor of chromosome evolution is discussed. The association of size and structure of telomeric regions with replicative aging and cell immortalization is considered. The review deals in detail with classical and alternative mechanisms of telomere size control, the significance of changes in telomeric region length in ontogeny, oncotransformation, and evolution. The issues related to telomere destabilization and the role of this process in chromosome rearrangement formation and chromosome evolution are discussed. The origin of telomere repeats in interstitial chromosome sites, including regions of evolutionary fusions-fissions is given special consideration. The possible role of ribosomal repeats and mechanisms similar to ALT (alternative lengthening of telomeres) in telomere reorganization in some taxa are discussed.     

Terminal regions of mammal chromosomes: plasticity and role in evolution

The review considers data on the composition, organization, and functional significance of terminal regions in mammalian chromosomes, including telomeres and subtelomeric regions. Because of specific structure, features of DNA replication, and characteristic localization in somatic and meiotic cells, these regions are hot spots for many events associated with genome functioning in mammals. Instability of these regions is of special interest. Evidence suggesting that instability of chromosomal regions containing telomeric DNA is a factor of chromosome evolution is discussed. The association of size and structure of telomeric regions with replicative aging and cell immortalization is considered. The review deals in detail with classical and alternative mechanisms of telomere size control, the significance of changes in telomeric region length in ontogeny, oncotransformation, and evolution. The issues related to telomere destabilization and the role of this process in chromosome rearrangement formation and chromosome evolution are discussed. The origin of telomere repeats in interstitial chromosome sites, including regions of evolutionary fusions-fissions is given special consideration. The possible role of ribosomal repeats and mechanisms similar to ALT (alternative lengthening of telomeres) in telomere reorganization in some taxa are discussed.     

Telomeric DNA allocation in chromosomes of common shrew (Sorex araneus, eulipotyphla)

Recently, we displayed an Iberian shrew species (Sorex granarius) with telomere structures unusual for mammals. Long telomeres on the short acrocentric arms contain an average of 213 kb of telomere repeats, whereas the other chromosomal ends have only 3.8 kb (Zhdanova et al., 2005; 2007). However, it is not clear whether these telomeres are typical for all shrew species or only for S. granarius. S. granarius and common shrew Sorex araneus are sibling species. In this study, using modified Q-FISH we demonstrated that telomeres in S. araneus from various chromosomal races distinguished by their number of metacentrics contain 6.8–15.2 kb of telomeric tracts. The S. araneus telomere lengths appear to correspond to telomere lengths in the majority of both shrew species and wild mammals, whereas S. granarius has telomeres with unique or rare structures. Using DNA and RNA high-specific modified probes to telomeric repeats (PNA and LNA), we showed that interstitial telomeric sites in S. araneus chromosomes contain mainly telomeric DNA and that their localization coincide with some evolutionary breakpoints. Interstitial telomeric DNA in S. granarius chromosomes was not revealed. Thus, the distribution of telomeric DNA may be significantly different, even in closely related species whose chromosomes are composed of almost identical chromosomal arms.     

Telomeric DNA in chromosomes of five opisthorchid species

The analysis of telomere repeat distribution in chromosomes of five opisthorchid species (Opisthorchis felineus (Rivolta, 1884), Opisthorchis viverrini (Poirier, 1886), Metorchis xanthosomus (Creplin, 1846), Metorchis bilis (Braun, 1890), Clonorchis sinensis (Cobbold, 1875)) was performed with fluorescent in situ hybridization (FISH) of labeled (TTAGGG)n DNA-probe and PNA telomere probe on mitotic and meiotic chromosomes of these species. It was shown that chromosome telomeres of all studied species contain large clusters of (TTAGGG)n telomeric repeats. Interstitial clusters of the (TTAGGG)n repeats have not been revealed in the chromosomes of any studied species even when FISH of PNA telomere probe on pachytene chromosomes was performed. Furthermore interstitial clusters of the (TTAGGG)n repeats have not been detected in the chromosomes of O. viverrini, one of chromosomes of this species is the result of a fusion of two ancestral opisthorchid chromosomes.