Analysis of the RNA of defective VSV particles

Viral mRNA isolated from infected cells and the virion RNA isolated from two classes of defective interfering particles have been analyzed by RNA-RNA duplex reactions. The results show that the RNA of both defective interfering particles is viral, not host in origin. The RNA isolated from the two defective particles represents homogeneous populations of molecules containing only part of the genetic information present in the whole VSV genome. Annealing competition experiments indicate that if any overlap exists between the two, it is less than 220 nucleotides. We conclude from the data presented that a rudimentary physical map of the VSV and DI particle genomes is

Our results suggest that there is not a single specific site that is required for autointerference.     

Force generation in RNA polymerase.

RNA polymerase (RNAP) is a processive molecular motor capable of generating forces of 25-30 pN, far in excess of any other known ATPase. This force derives from the hydrolysis free energy of nucleotides as they are incorporated into the growing RNA chain. The velocity of procession is limited by the rate of pyrophosphate release. Here we demonstrate how nucleotide triphosphate binding free energy can rectify the diffusion of RNAP, and show that this is sufficient to account for the quantitative features of the measured load-velocity curve. Predictions are made for the effect of changing pyrophosphate and nucleotide concentrations and for the statistical behavior of the system.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

An RNA polymerase pause site is associated with the immunoglobulin mus poly(A) site

Immunoglobulin mu alternative RNA processing is regulated during B-cell maturation and requires balanced efficiencies of the competing splice (mum) and cleavage-polyadenylation (mus) reactions. When we deleted sequences 50 to 200 nucleotides beyond the mus poly(A) site, the mus/mum mRNA ratio decreased three- to eightfold in B, plasma, and nonlymphoid cells. The activity could not be localized to a smaller fragment but did function in heterologous contexts. Our data suggest that this region contains an RNA polymerase II pause site that enhances the use of the mus poly(A) site. First, known pause sites replaced the activity of the deleted fragment. Second, the mu fragment, when placed between tandem poly(A) sites, enhanced the use of the upstream poly(A) site. Finally, nuclear run-ons detected an increase in RNA polymerase loading just downstream from the mus poly(A) site, even when the poly(A) site was inactivated. When this mu fragment and another pause site were inserted 1 kb downstream from the mus poly(A) site, they no longer affected the mRNA expression ratio, suggesting that pause sites affect poly(A) site use over a limited distance. Fragments from the immunoglobulin A gene were also found to have RNA polymerase pause site activity.     

GroEL is involved in activation of Escherichia coli RNA polymerase devoid of the omega subunit in vivo.

Highly purified Escherichia coli RNA polymerase contains a small subunit termed omega that has a molecular mass of 10 105 Da and is comprised of 91 amino acids. E. coli strains lacking omega (omega-less) are viable, but exhibit a slow-growth phenotype. Renaturation of RNA polymerase isolated from an omega-less mutant, in the presence of omega, resulted in maximum recovery of activity. The omega-less RNA polymerase from omega-less strains recruits the chaperonin, GroEL (unlike the wild-type enzyme), suggesting a structural deformity of the mutant enzyme. The GroEL-containing core RNA polymerase interacts efficiently with sigma70 to generate the fully functional holoenzyme. However, when GroEL was removed, the enzyme was irreversibly nonfunctional and was unable to bind to sigma70. The damaged enzyme regained activity after going through a cycle of denaturation and reconstitution in the presence of omega or GroEL. GroES was found to have an inhibitory effect on the core-sigma70 association unlike the omega subunit. The omega subunit may therefore be needed for stabilization of the structure of RNA polymerase.     

DNA strand specificity in promoter recognition by RNA polymerase.

DNA strand and enzyme subunit specificities involved in the interaction between E. coli RNA polymerase and T7 DNA were studied by photo-crosslinking techniques. In non-specific enzyme-DNA complexes, subunits, sigma, beta, and beta' were crosslinked to both strands of the DNA. Under conditions leading to specific enzyme-promoter complexes, however, only sigma and beta subunits were crosslinked. The sigma subunit was crosslinked preferentially to the non-sense strand at promoter sites. No such strand specificity was observed for the beta subunit. These results provide insight into the molecular mechanism of promoter recognition and indicate that the interaction between RNA polymerase and DNA template is different at promoters and at non-specific sites.