E. coli DNA binding protein HU forms nucleosomelike structure with circular double-stranded DNA.

The incubation of the E coli DNA binding protein HU with relaxed circular SV40 DNA in the presence of pure nicking-closing enzyme introduces up to 18 negative superhelical turns in the DNA molecules as measured by agarose gel electrophoresis. The maximal density of supercoiling is obtained at a HU-DNA mass ratio of 1. Reconstituted DNA-HU complexes prefixed with glutaraldehyde appear as condensed circular structures having an average of 14 "beads" per circular SV40 DNA molecule, with a "bead" diameter of 180 +/- 23 A. The circular SV40 DNA is condensed by a ratio of 2.0-2.5 relative to naked DNA. This is similar to the ratio (2.4) measured for chromatin formed by reassociation of relaxed SV40 DNA with the four core histones.     

Two forms of UvrC protein with different double-stranded DNA binding affinities

Using phosphocellulose followed by single-stranded DNA-cellulose chromatography for purification of UvrC proteins from overproducing cells, we found that UvrC elutes at two peaks: 0.4 m KCl (UvrCI) and 0.6 m KCl (UvrCII). Both forms of UvrC have a major peptide band (>95%) of the same molecular weight and identical N-terminal amino acid sequences, which are consistent with the initiation codon being at the unusual GTG site. Both forms of UvrC are active in incising UV-irradiated, supercoiled phiX-174 replicative form I DNA in the presence of UvrA and UvrB proteins; however, the specific activity of UvrCII is one-fourth that of UvrCI. The molecular weight of UvrCII is four times that of UvrCI on the basis of results of size exclusion chromatography and glutaraldehyde cross-linking reactions, indicating that UvrCII is a tetramer of UvrCI. Functionally, these two forms of UvrC proteins can be distinguished under reaction conditions in which the protein/nucleotide molar ratio is >0.06 by using UV-irradiated, (32)P-labeled DNA fragments as substrates; under these conditions UvrCII is inactive in incision, but UvrCI remains active. The activity of UvrCII in incising UV-irradiated, (32)P- labeled DNA fragments can be restored by adding unirradiated competitive DNA, and the increased level of incision corresponds to a decreased level of UvrCII binding to the substrate DNA. The sites of incision at the 5' and 3' sides of a UV-induced pyrimidine dimer are the same for UvrCI and UvrCII. Nitrocellulose filter binding and gel retardation assays show that UvrCII binds to both UV-irradiated and unirradiated double-stranded DNA with the same affinity (K(a), 9 x 10(8)/m) and in a concentration-dependent manner, whereas UvrCI does not. These two forms of UvrC were also produced by the endogenous uvrC operon. We propose that UvrCII-DNA binding may interfere with Uvr(A)(2)B-DNA damage complex formation. However, because of its low copy number and low binding affinity to DNA, UvrCII may not interfere with Uvr(A)(2)B-DNA damage complex formation in vivo, but instead through double-stranded DNA binding UvrCII may become concentrated at genomic areas and therefore may facilitate nucleotide excision repair.     

Interaction between the adenovirus DNA-binding protein and double-stranded DNA.

DNA-binding protein was characterized by previous investigators as a single-stranded DNA-binding protein analogous to the gene 32 protein of phage T4 (Van der Vliet &; Levine, 1973; Sugawara et al., 1977). In the studies presented here the interactions between natural and synthetic polynucleotides and the DNA-binding protein of adenovirus 2-infected HeLa cells have been examined. Polynucleotide melting techniques revealed a tight yet dissociable binding to the helix structure of double-stranded DNA. In addition, binding and filter binding competition experiments at high DNA to protein ratios revealed a specific binding to double-stranded DNA termini with a dissociation constant of 1 × 10^?9 to 2 × 10^?9m. The ability of DNA-binding protein to bind to heat-denatured viral DNA was confirmed but the binding to double-stranded DNA termini was more specific on a molar basis. DNA-binding protein can recognize both flush and staggered ends of double-stranded DNA molecules.     

Structural alterations of double-stranded DNA in complex with the adenovirus DNA-binding protein. Implications for its function in DNA replication.

The Adenovirus DNA-binding protein (DBP) binds to single-stranded (ss) DNA as well as to double-stranded (ds) DNA and forms multimeric protein-DNA complexes with both. Gel retardation assays indicate rapid complex formation for both DNAs. DBP rapidly dissociates from dsDNA, indicating a dynamic equilibrium, whereas the ssDNA-DBP complex is much more stable. We investigated the complex between DBP and dsDNA in more detail. Electron microscopical analysis shows thick filament-like and beaded structures in which the length of the DNA is not significantly altered. Cryo-electron micrographs suggest the presence of interwound protein fibres around the DNA. Ligase-mediated cyclization, but not linear multimerization, of DBP-saturated DNA fragments exceeding the persistence length was severely inhibited. This suggests that DNA may be organized by DBP into a rigid structure. Under those conditions, DBP induces distinct changes in the circular dichroism spectrum of the DNA, indicative of structural DNA changes. No bending or twisting of the complex was observed. Hydroxyl radical footprinting showed that the breakdown pattern of DNA at saturating DBP concentrations is much more regular than the protein-free DNA. This suggests the removal of tertiary structures, which may be related to the effects of DBP on enhanced NFI binding and chain elongation during Adenovirus DNA replication. Using purified proteins in an in vitro replication system, we correlate the structural changes with the effects of DBP on enhancement of NFI-binding as well as on DNA replication.     

Recognition site of nuclear factor I, a sequence-specific DNA-binding protein from HeLa cells that stimulates adenovirus DNA replication.

Nuclear factor I is a 47-kd protein, isolated from nuclei of HeLa cells, that binds specifically to the inverted terminal repeat of the adenovirus (Ad) DNA and enhances Ad DNA replication in vitro. We have studied the DNA sequence specificity of nuclear factor I binding using cloned terminal fragments of the Ad2 genome and a set of deletion mutants. Binding of nuclear factor I protects nucleotides 19-42 of Ad2 DNA against DNase I digestion. Filter binding assays show that deletion of the first 23 nucleotides does not impair binding while a deletion of 24 nucleotides reduces binding severely. However, binding studies on Ad12 DNA indicate that nucleotide 24 can be mutated. Fragments containing the first 40 bp are bound normally while the first 38 bp are insufficient to sustain binding. Taken together, these results indicate that the minimal recognition site of nuclear factor I contains 15 or 16 nucleotides, located from nucleotide 25 to nucleotide 39 or 40 of the Ad2 DNA. This site contains two of the four conserved nucleotide sequences in this region. Sequences flanking the minimal recognition site may reduce the binding affinity of nuclear factor I. In accordance with these binding studies, DNA replication of a fragment that carries the sequence of the terminal 40 nucleotides of Ad2 at one molecular end is enhanced by nuclear factor I in an in vitro replication system.     

Site-specific DNA binding of nuclear factor I: analyses of cellular binding sites.

Nuclear factor I is a cellular site-specific DNA-binding protein required for the efficient in vitro replication of adenovirus DNA. We have characterized human DNA sequences to which nuclear factor I binds. Three nuclear factor I binding sites (FIB sites), isolated from HeLa cell DNA, each contain the sequence TGG(N)6-7GCCAA. Comparison with other known and putative FIB sites suggests that this sequence is important for the binding of nuclear factor I. Nuclear factor I protects a 25- to 30-base-pair region surrounding this sequence from digestion by DNase I. Methylation protection studies suggest that nuclear factor I interacts with guanine residues within the TGG(N)6-7GCCAA consensus sequence. One binding site (FIB-2) contained a restriction endonuclease HaeIII cleavage site (GGCC) at the 5' end of the GCCAA motif. Digestion of FIB-2 with HaeIII abolished the binding of nuclear factor I. Southern blot analyses indicate that the cellular FIB sites described here are present within single-copy DNA in the HeLa cell genome.     

Adenovirus DNA replication in vitro: site-directed mutagenesis of the nuclear factor I binding site of the Ad2 origin.

The template requirements for efficient adenovirus DNA replication were studied in vitro in a reconstituted system with cloned DNA fragments, containing the Ad2 origin region, as templates. Replication is enhanced by nuclear factor I, a cellular protein that binds specifically to the Ad2 origin. This stimulation is shown to be strongly dependent on the concentration of the adenovirus DNA binding protein. Using synthetic oligonucleotides we have constructed plasmids with base substitutions in the nuclear factor I binding region. Footprint analysis and competition filter binding studies show that two of the three small blocks of conserved nucleotides in this region are involved in the binding of nuclear factor I. The binding affinity can be influenced by the base composition of the degenerate region just outside these two blocks. In vitro initiation and DNA chain elongation experiments with the mutants demonstrate that binding of nuclear factor I to the Ad2 origin is necessary for stimulation. However, binding alone is not always sufficient since a mutation which only slightly disturbs binding is strongly impaired in stimulation of DNA replication by nuclear factor I.     

Analysis of nuclear factor I binding to DNA using degenerate oligonucleotides.

Nuclear factor I (NFI) binds tightly to DNA containing the consensus sequence TGG(N)6-7GCCAA. To study the role of the spacing between the TGG and GCCAA motifs, oligonucleotides homologous to the NFI binding site FIB-2 were synthesized and used for binding assays in vitro. The wild-type site (FIB-2.6) has a 6bp spacer region and binds tightly to NFI. When the size of this spacer was altered by +/- 1 or 2bp the binding to NFI was abolished. To further assess the role of the spacer and bases flanking the motifs, two oligonucleotide libraries were synthesized. Each member of these libraries had intact TGG and GCCAA motifs, but the sequence of the spacer and the 3bp next to each motif was degenerate. The library with a 6bp spacer bound to NFI to 40-50% the level of FIB-2.6. The library with a 7bp spacer bound to NFI to only 4% the level of FIB-2.6 and some of this binding was weaker than that of FIB-2.6 DNA. This novel use of degenerate DNA libraries has shown that: 1) the structural requirements for FIB sites with a 7bp spacer are more stringent than for sites with a 6bp spacer and 2) a limited number of DNA structural features can prevent the binding of NFI to sites with intact motifs and a 6bp spacer region.     

Interaction of DNA with DNA-binding proteins: protein exchange and complex stability.

The competition of the DNA-binding proteins I and II of Escherichia coli and of the phage fd DNA-binding protein for single-stranded DNA was investigated. Their roles in cells might be judged from their binding affinities to DNA and their mutual exchange in the DNA . protein complexes. Strongest binding on single strands was found for the phage protein. DNA-binding protein II displaced half of the protein I in the complex with single-stranded DNA when no double-stranded DNA was present. Protein-complexed single strands were protected against degradation. The protection is less pronounced for protein II which can increase the stability of the fd DNA complex with DNA-binding protein I against nucleolytic cleavage.     

Purified presequence binding factor (PBF) forms an import-competent complex with a purified mitochondrial precursor protein.

In vitro mitochondrial import of the purified precursor form (pOTC) of rat ornithine carbamoyltransferase (OTC) is stimulated by a cytosolic factor(s) contained in rabbit reticulocyte lysate. A protein factor that binds to pOTC but not to mature OTC and was named presequence binding factor or PBF, was purified 91,000-fold from the lysate by affinity chromatography using pOTC-bound Sepharose, DEAE-5PW HPLC and sucrose gradient centrifugation. The purified PBF migrated as a single polypeptide of 50,000 daltons on SDS-PAGE. On sucrose gradients, urea-denatured pOTC sedimented to the bottom, whereas PBF sedimented with an S20,w value of 5.5S. When pOTC and PBF were centrifuged together, both polypeptides sedimented as a complex of 7.1S. Formation of the pOTC-PBF complex was inhibited by micromolar concentrations of the synthetic presequence of pOTC and those of other mitochondrial precursor proteins. The purified PBF markedly stimulated the import of purified or in vitro synthesized pOTC into the mitochondria. PBF-stimulated pOTC import was further enhanced by a 70 kd heat shock protein (hsp 70) purified from yeast; the hsp70 alone had little effect. Thus, PBF binds to the presequence portion of the precursors and may hold them in a transport-competent form in cooperation with hsp70.     

Nuclear factor I enhances adenovirus DNA replication by increasing the stability of a preinitiation complex.

Nuclear factor I (NFI) or its isolated DNA-binding domain (NFI-BD) enhances initiation of adenovirus DNA replication up to 50-fold at low concentrations of the precursor terminal protein-DNA polymerase (pTP-pol) complex. Both in solution and when bound to DNA, NFI-BD can form a complex with pTP-pol. To investigate the mechanism of enhancement by NFI, we determined the stability of a functional preinitiation complex formed in vitro between pTP-pol and the origin. Challenge experiments with a distinguishable template containing an identical origin revealed that in the absence of NFI, this preinitiation complex was very sensitive to competition for pTP-pol. Addition of NFI-BD increased the half-life of the complex at least 10-fold and led to the formation of a template-committed preinitiation complex. In agreement with this, binding of pTP-pol to origin DNA in band-shift assays was enhanced by NFI. By DNase I footprinting we show that the specificity of binding as well as induction of structural changes in origin DNA by pTP-pol are increased by NFI. These results indicate that NFI, by binding and positioning pTP-pol, stabilizes the complex between pTP-pol and the core origin, and thus enhances initiation of DNA replication.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

RFP is a DNA binding protein associated with the nuclear matrix.

We reported that the RFP gene encodes a protein with putative zinc finger domains and was involved in the activation of the ret proto-oncogene. To further characterize the RFP protein, we developed a polyclonal antibody against the product synthesized from a fragment of the RFP cDNA expressed in Escherichia coli. Western blot analysis showed that RFP was identified as a 58 kDa protein in cell lysates from four human and rodent cell lines and from mouse testis. In addition, a unique 68 kDa protein was detected in the testis. Using AH7974 (rat ascites hepatoma) and Raji (human Burkitt lymphoma) cells, we demonstrated strong association of RFP with the nuclear matrix. Furthermore, RFP solubilized from the nuclear matrix had DNA-binding activity although it appears to bind more preferentially to double-stranded DNA than to single-stranded DNA. These results thus suggest that RFP may play a role in molecular processes which occur in the nuclear matrix.     

Evidence for ATP binding and double-stranded DNA binding by Escherichia coli RecF protein.

RecF protein is one of the important proteins involved in DNA recombination and repair. RecF protein has been shown to bind single-stranded DNA (ssDNA) in the absence of ATP (T. J. Griffin IV and R. D. Kolodner, J. Bacteriol. 172:6291-6299, 1990; M. V. V. S. Madiraju and A. J. Clark, Nucleic Acids Res. 19:6295-6300, 1991). In the present study, using 8-azido-ATP, a photo-affinity analog of ATP, we show that RecF protein binds ATP and that the binding is specific in the presence of DNA. 8-Azido-ATP photo-cross-linking is stimulated in the presence of DNA (both ssDNA and double-stranded DNA [dsDNA]), suggesting that DNA enhances the affinity of RecF protein for ATP. These data suggest that RecF protein possesses independent ATP- and DNA-binding sites. Further, we find that stable RecF protein-dsDNA complexes are obtained in the presence of ATP or ATP-gamma-S [adenosine-5'-O-(3-thio-triphosphate)]. No other nucleoside triphosphates served as necessary cofactors for dsDNA binding, indicating that RecF is an ATP-dependent dsDNA-binding protein. Since a mutation in a putative phosphate-binding motif of RecF protein results in a recF mutant phenotype (S. J. Sandler, B. Chackerian, J. T. Li, and A. J. Clark, Nucleic Acids Res. 20:839-845, 1992), we suggest on the basis of our data that the interactions of RecF protein with ATP, with dsDNA, or with both are physiologically important for understanding RecF protein function in vivo.     

Evidence for nuclear and DNA binding forms of the receptor-glucocorticoid complex from hepatoma tissue culture cells.

Binding to DNA associated with cellulose has been used to investigate the receptor-glucocorticoid complex isolated from a line of rat hepatoma tissue culture cells. The amount of activated complex that bound to DNA was approximately half that which bound to nuclei. Additional results suggest the existence of two forms of the activated glucocorticoid receptor-steroid complex in about equal amounts: one form binds only to nuclei and the other binds to DNA and nuclei. The two forms also differ in their stability, with the DNA/nuclei binging form being relatively labile. The binding of either form to the appropriate acceptor is reduced by cytosol inhibitors by the same mechanism.