Sequence requirements for the activity of membrane-active peptides.

Synthetic peptides were constructed with the sequence of the first 20 residues of melittin and terminating with a range of different amino acid amides. These were found to have haemolytic and cytolytic activity similar to that of melittin, provided that certain charge constraints were observed. The nature of the 21st residue was not critical except when the residue introduced a negative charge. The presence of at least two positive charges in the molecule was found to be essential for activity. One of these charges could be the amino-terminal amine. Peptides could be inactivated by the addition of a non-acidic presequence which was acetylated at the N-terminus. Introducing a protease cleavable sequence into an N-terminal extension of the peptides produced analogues with low haemolytic activity that could be activated by proteolytic action. A peptide with extra positive charges introduced on the hydrophilic face of the helix possessed a haemolytic activity that was greater than that of melittin.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Sequence requirements for precursor cleavage within the constitutive secretory pathway.

We have recently demonstrated that the Arg-X-Lys/Arg-Arg sequence is a signal for precursor cleavage catalyzed by furin, a mammalian homologue of the yeast precursor-processing endoprotease Kex2, within the constitutive secretory pathway. In this study, we further examined sequence requirements for the constitutive precursor cleavage by expression of various prorenin mutants with amino acid substitutions around the native Lys-Arg cleavage site in Chinese hamster ovary cells. The results delineate the following sequence rules that govern the constitutive precursor cleavage. (a) A basic residue (Lys or Arg) at the 4th (position -4) or 6th (position -6) residue upstream of the cleavage site besides basic residues at positions -1 and -2 is necessary. (b) At position -2, a Lys residue is more preferable than Arg. (c) At position -4, an Arg residue is more preferable than Lys. (d) At position 1, a hydrophobic aliphatic amino acid is not suitable.     

Sequence requirements for self-splicing of the Tetrahymena thermophila pre-ribosomal RNA.

The sequence requirements for splicing of the Tetrahymena pre-rRNA have been examined by altering the rRNA gene to produce versions that contain insertions and deletions within the intervening sequence (IVS). The altered genes were transcribed and the RNA tested for self-splicing in vitro. A number of insertions (8-54 nucleotides) at three locations had no effect on self-splicing activity. Two of these insertions, located at a site 5 nucleotides preceding the 3'-end of the IVS, did not alter the choice of the 3' splice site. Thus the 3' splice site is not chosen by its distance from a fixed point within the IVS. Analysis of deletions constructed at two sites revealed two structures, a hairpin loop and a stem-loop, that are entirely dispensable for IVS excision in vitro. Three other regions were found to be necessary. The regions that are important for self-splicing are not restricted to the conserved sequence elements that define this class of intervening sequences. The requirement for structures within the IVS for pre-rRNA splicing is in sharp contrast to the very limited role of IVS structure in nuclear pre-mRNA splicing.     

Sequence requirements for plasmid nuclear import

The nuclear envelope is a major barrier for nuclear uptake of plasmids and represents one of the most significant unsolved problems of nonviral gene delivery. We have previously shown that the nuclear entry of plasmid DNA is sequence-specific, requiring a 366-bp fragment containing the SV40 origin of replication and early promoter. In this report, we show that, although fragments throughout this region can support varying degrees of nuclear import, the 72-bp repeats of the SV40 enhancer facilitate maximal transport. The functions of the promoter and the origin of replication are not needed for nuclear localization of plasmid DNA. In contrast to the import activity of the SV40 enhancer, two other strong promoter and enhancer sequences, the human cytomegalovirus (CMV) immediate-early promoter and the Rous sarcoma virus LTR, were unable to direct nuclear localization of plasmids. The inability of the CMV promoter to mediate plasmid nuclear import was confirmed by measurement of the CMV promoter-driven expression of green fluorescent protein (GFP) in microinjected cells. At times before cell division, as few as 3 to 10 copies per cell of cytoplasmically injected plasmids containing the SV40 enhancer gave significant GFP expression, while no expression was obtained with more than 1000 copies per cell of plasmids lacking the SV40 sequence. However, the levels of expression were the same for both plasmids after cell division in cytoplasmically injected cells and at all times in nuclear injected cells. Thus, the inclusion this SV40 sequence in nonviral vectors may greatly increase their ability to be transported into the nucleus, especially in nondividing cells.     

Further studies on the structural requirements for mast cell degranulating (MCD) peptide-mediated histamine release

Mast cell degranulating (MCD) peptide was modified in its two disulfide bridges and in the two arginine residues in order to measure the ability of these analogs to induce histamine release from mast cells in vitro. Analogs prepared were [Ala^3,15]MCD, [Ala^5,19]MCD, [Orn¹⁶]MCD, and [Orn^7,16]MCD. Their histamine-releasing activity was determined spectrofluorometrically with peritoneal mast cells. The monocyclic analogs in which the cysteine residues were replaced pairwise with alanine residues showed three-to ten-fold diminished histamine-releasing activity respectively, compared with the parent MCD peptide. Substantial increases in activity were observed where arginine residues were replaced by ornithines. The ornithine-mono substituted analog showed an almost six-fold increase and the ornithine-doubly substituted analog three-fold increase in histamine-releasing activity compared with the parent MCD peptide. The structural changes associated with these activities were followed by circular dichroism (CD) spectroscopy. Changes in the shape and ellipticity of the CD spectra reflected a role for the disulfide bonds and the two arginine residues in the overall conformation and biological activity of the molecule.     

Sequence requirements of the hammerhead RNA self-cleavage reaction.

A previously well-characterized hammerhead catalytic RNA consisting of a 24-nucleotide substrate and a 19-nucleotide ribozyme was used to perform an extensive mutagenesis study. The cleavage rates of 21 different substrate mutations and 24 different ribozyme mutations were determined. Only one of the three phylogenetically conserved base pairs but all nine of the conserved single-stranded residues in the central core are needed for self cleavage. In most cases the mutations did not alter the ability of the hammerhead to assemble into a bimolecular complex. In the few cases where mutant hammerheads did not assemble, it appeared to be the result of the mutation stabilizing an alternate substrate or ribozyme secondary structure. All combinations of mutant substrate and mutant ribozyme were less active than the corresponding single mutations, suggesting that the hammerhead contains few, if any, replaceable tertiary interactions as are found in tRNA. The refined consensus hammerhead resulting from this work was used to identify potential hammerheads present in a variety of Escherichia coli gene sequences.     

Ethanol-induced translocation of cAMP-dependent protein kinase to the nucleus. Mechanism and functional consequences.

Ethanol induces translocation of the catalytic subunit (Calpha) of cAMP-dependent protein kinase (PKA) from the Golgi area to the nucleus in NG108-15 cells. Ethanol also induces translocation of the RIIbeta regulatory subunit of PKA to the nucleus; RI and Cbeta are not translocated. Nuclear PKA activity in ethanol-treated cells is no longer regulated by cAMP. Gel filtration and immunoprecipitation analysis confirm that ethanol blocks the reassociation of Calpha with RII but does not induce dissociation of these subunits. Ethanol also reduces inhibition of Calpha by the PKA inhibitor PKI. Pre-incubation of Calpha with ethanol decreases phosphorylation of Leu-Arg-Arg-Ala-Ser-Leu-Gly (Kemptide) and casein but has no effect on the phosphorylation of highly charged molecules such as histone H1 or protamine. cAMP-response element-binding protein (CREB) phosphorylation by Calpha is also increased in ethanol-treated cells. This increase in CREB phosphorylation is inhibited by the PKA antagonist (R(p))-cAMPS and by an adenosine receptor antagonist. These results suggest that ethanol affects a cascade of events allowing for sustained nuclear localization of Calpha and prolonged CREB phosphorylation. These events may account for ethanol-induced changes in cAMP-dependent gene expression.     

Dynamics of diacylglycerol kinase zeta translocation in living T-cells. Study of the structural domain requirements for translocation and activity

The diacylglycerol kinases (DGK) regulate diacylglycerol-based signals by phosphorylating this key lipid intermediate to phosphatidic acid. Here, we have investigated the spatial and temporal regulation of diacylglycerol kinase zeta (DGK zeta) in living Jurkat T-cells expressing a muscarinic type I receptor. Using real time confocal videomicroscopy, we show the rapid translocation of a green fluorescent protein-tagged enzyme from the cytosol to the plasma membrane following receptor stimulation. The generation of a panel of truncations, deletions, and point mutations of the enzyme allowed us to examine the requirements of the different structural motifs for both activity and receptor-regulated translocation. The data show that DGK zeta has strict requirements for intact zinc fingers and the conserved catalytic domain for full enzymatic activity. Protein kinase C-driven myristoylated alanine-rich C kinase substrate domain phosphorylation and intact zinc fingers are in turn essential for plasma membrane translocation. DGK zeta does not translocate to the membrane following stimulation of the endogenous T-cell receptor, and our data demonstrate that the specificity in terms of receptor response is provided by the regulatory motifs present at the C-terminal domain of the protein. This is the first report that shows in vivo DGK zeta translocation in response to agonist stimulation and establishes the role of the different domains in enzymatic activity and the selectivity of the response to receptors.     

Energy requirements for protein translocation across the Escherichia coli inner membrane

Both ATP and an electrochemical potential play roles in translocating proteins across the inner membrane of Escherichia coli. Recent discoveries have dissected the overall transmembrane movement into separate subreactions with different energy requirements, identified a translocation ATPase, and reconstituted both energy-requiring steps of the reaction from purified components. A more refined understanding of the energetics of this fundamental process is beginning to provide answers about the basic issues of how proteins move across the hydrophobic membrane barrier.     

Insulin-induced translocation of IR to the nucleus in insulin responsive cells requires a nuclear translocation sequence

Insulin binding to its cell surface receptor (IR) activates a cascade of events leading to its biological effects. The Insulin-IR complex is rapidly internalized and then is either recycled back to the plasma membrane or sent to lysosomes for degradation. Although most of the receptor is recycled or degraded, a small amount may escape this pathway and migrate to the nucleus of the cell where it might be important in promulgation of receptor signals. In this study we explored the mechanism by which insulin induces IR translocation to the cell nucleus. Experiments were performed cultured L6 myoblasts, AML liver cells and 3T3-L1 adipocytes. Insulin treatment induced a rapid increase in nuclear IR protein levels within 2 to 5?min. Treatment with WGA, an inhibitor of nuclear import, reduced insulin-induced increases nuclear IR protein; IR was, however, translocated to a perinuclear location. Bioinformatics tools predicted a potential nuclear localization sequence (NLS) on IR. Immunofluorescence staining showed that a point mutation on the predicted NLS blocked insulin-induced IR nuclear translocation. In addition, blockade of nuclear IR activation in isolated nuclei by an IR blocking antibody abrogated insulin-induced increases in IR tyrosine phosphorylation and nuclear PKCδ levels. Furthermore, over expression of mutated IR reduced insulin-induced glucose uptake and PKB phosphorylation. When added to isolated nuclei, insulin induced IR phosphorylation but had no effect on nuclear IR protein levels. These results raise questions regarding the possible role of nuclear IR in IR signaling and insulin resistance.     

Charge requirements for proton gradient-driven translocation of anthrax toxin

Anthrax lethal toxin is used as a model system to study protein translocation. The toxin is composed of a translocase channel, called protective antigen (PA), and an enzyme, called lethal factor (LF). A proton gradient (ΔpH) can drive LF unfolding and translocation through PA channels; however, the mechanism of ΔpH-mediated force generation, substrate unfolding, and establishment of directionality are poorly understood. One recent hypothesis suggests that the ΔpH may act through changes in the protonation state of residues in the substrate. Here we report the charge requirements of LF's amino-terminal binding domain (LF(N)) using planar lipid bilayer electrophysiology. We found that acidic residues are required in LF(N) to utilize a proton gradient for translocation. Constructs lacking negative charges in the unstructured presequence of LF(N) translocate independently of the ΔpH driving force. Acidic residues markedly increase the rate of ΔpH-driven translocation, and the presequence is optimized in its natural acidic residue content for efficient ΔpH-driven unfolding and translocation. We discuss a ΔpH-driven charge state Brownian ratchet mechanism for translocation, where glutamic and aspartic acid residues in the substrate are the "molecular teeth" of the ratchet. Our Brownian ratchet model includes a mechanism for unfolding and a novel role for positive charges, which we propose chaperone negative charges through the PA channel during ΔpH translocation.     

Specificity of the hairpin ribozyme. Sequence requirements surrounding the cleavage site.

Substrate sequence requirements of the hairpin ribozyme have been partially defined by both mutational and in vitro selection experiments. It was considered that the best targets were those that included the N downward arrowGUC sequence surrounding the cleavage site. In contrast to previous studies that failed to evaluate all possible combinations of these nucleotides, we have performed an exhaustive analysis of the cleavage of 64 substrate variants. They represent all possible sequence combinations of the J2/1 nucleotides except the well established G(+1). No cleavage was observed with 24 sequences. C(+2) variants showed little or no cleavage, whereas U(+2) substrates were all cleavable. The maximal cleavage rate was obtained with the AGUC substrate. Cleavage rates of sequences HGUC (H = A, C, or U), GGUN, GGGR (R = A or G), AGUU, and UGUA were up to 5 times lower than the AGUC one. This shows that other sequences besides NGUC could also be considered as good targets. A second group of sequences WGGG (W = A or U), UGUK (K = G or U), MGAG (M = A or C), AGUA, and UGGA were cleaved between 6 and 10 times less efficiently. Furthermore, the UGCU sequence of a noncleavable viral target was mutated to AGUC resulting in a proficiently cleavable substrate by its cognate hairpin ribozyme. This indicates that our conclusions may be extrapolated to other hairpin ribozymes with different specificity.     

Switch in antiviral specificity of a GTPase upon translocation from the cytoplasm to the nucleus.

The Mx2 protein of rats is a cytoplasmic GTPase that protects cells against vesicular stomatitis virus but not against influenza virus. Since vesicular stomatitis virus replicates in the cytoplasm and influenza virus replicates in the nucleus, it was possible that the antiviral specificity of rat Mx2 protein was determined solely by the protein's subcellular localization. Here, we found that, indeed, rat Mx2 protein lost its anti-vesicular stomatitis virus activity and gained anti-influenza virus activity when it was directed to the nucleus by way of a foreign nuclear-transport signal appended to its amino terminus. These data show that rat Mx2 protein possesses an antiviral activity that is revealed only when the protein is shuttled to the nucleus.     

Sequence requirements for branch formation in a group II self-splicing intron.

Evidence is presented for the existence of a specific intron-intron interaction, necessary for the formation of the branched product in the self-splicing reaction of a group II yeast mitochondrial intron. Trans-splicing reactions involving two RNA molecules (5' exon with covalently linked regions of intron and intron with covalently linked 3' exon) show that the presence of portions of intron domain I on the 5' molecule is necessary for the formation of branched products which are not seen with shorter 5' molecules. Modification/interference reactions show regions necesary for branch-formation and support a major role for specific regions of intron domain I. Further experiments, utilizing a truncated 3' molecule that is missing the conserved branchpoint nucleotide, indicate that domain VI may be required for a successful domain I interaction. A model for the formation of a proper branched structure includes implications for both cis and trans configurations.     

Sequence and positional requirements for DNA sites in a mu transpososome.

Transposition of bacteriophage Mu uses two DNA cleavage sites and six transposase recognition sites, with each recognition site divided into two half-sites. The recognition sites can activate transposition of non-Mu DNA sequences if a complete set of Mu sequences is not available. We have analyzed 18 sequences from a non-Mu DNA molecule, selected in a functional assay for the ability to be transposed by MuA transposase. These sequences are remarkably diverse. Nonetheless, when viewed as a group they resemble a Mu DNA end, with a cleavage site and a single recognition site. Analysis of these "pseudo-Mu ends" indicates that most positions in the cleavage and recognition sites contribute sequence-specific information that helps drive transposition, though only the strongest contributors are apparent from mutagenesis data. The sequence analysis also suggests variability in the alignment of recognition half-sites. Transposition assays of specifically designed DNA substrates support the conclusion that the transposition machinery is flexible enough to permit variability in half-site spacing and also perhaps variability in the placement of the recognition site with respect to the cleavage site. This variability causes only local perturbations in the protein-DNA complex, as indicated by experiments in which altered and unaltered DNA substrates are paired.