Investigation of Cigarette Smoking among Male Schizophrenia Patients

Male schizophrenia patients are known to have a heavier smoking pattern compared with the general population. However, the mechanism for this association is not known, though hypothesis that smoking could alleviate symptomatology of schizophrenia and reduce side effects of antipsychotics has been suggested. The aims of this study were to validate the heavier smoking pattern among male schizophrenia patients and to investigate the possible mechanisms for the association. To enhance the reliability of the study, we recruited two large independent samples with 604 and 535 male Chinese schizophrenia patients, and compared their smoking pattern with that of 535 healthy male controls recruited from general population. Validated multiple indicators and multiple causes structure equation model and regression models were used to investigate the association of smoking with factors of schizophrenia symptomatology and with the usage of antipsychotics and their extra-pyramidal side effects (EPS). Schizophrenia patients had significantly heavier smoking pattern compared with healthy controls in our sample (42.4% vs. 16.8%, p<0.001 for current smoking prevalence; 23.5% vs. 43.3%, p<0.001 for smoking cessation rate; 24.5% vs. 3.0%, p<0.001 for heavy smoker proportion). Their smoking status was also found to be consistently and significantly associated with reduced negative factor scores for schizophrenia symptomatology (β = −0.123, p = 0.051 for sample-A; β = −0.103, p = 0.035 for sample-B; β = −0.082, p = 0.017 for the combined sample). However, no significant association was found between smoking and antipsychotics usage or risk of EPS. These results support that smoking is associated with improved negative symptoms, which could account for the heavier smoking pattern among schizophrenia patients.     

Vacuum infiltration enhances the Agrobacterium-mediated genetic transformation in Indian soybean cultivars

For the first time we have developed a reliable and efficient vacuum infiltration-assisted Agrobacterium-mediated genetic transformation (VIAAT) protocol for Indian soybean cultivars and recovered fertile transgenic soybean plants through somatic embryogenesis. Immature cotyledons were used as an explant and three Agrobacterium tumefaciens strains (EHA 101, EHA 105, and KYRT 1) harbouring the binary vector pCAMBIA1301 were experimented in the co-cultivation. The immature cotyledons were pre-cultured in liquid somatic embryo induction medium prior to vacuum infiltration with the Agrobacterium suspension and co-cultivated for 3 days on co-cultivation medium containing 50 mg l^?1 citric acid, 100 µM acetosyringone, and 100 mg l^?1 l-cysteine. The transformed somatic embryos were selected in liquid somatic embryo induction medium containing 10 mg l^?1 hygromycin and the embryos were germinated in basal medium containing 20 mg l^?1 hygromycin. The presence and integration of the hpt II and gus genes into the soybean genome were confirmed by GUS histochemical assay, polymerase chain reaction, and Southern hybridization. Among the different combinations tested, high transformation efficiency (9.45 %) was achieved when immature cotyledons of cv. Pusa 16 were pre-cultured for 18 h and vacuum infiltrated with Agrobacterium tumefaciens KYRT 1 for 2 min at 750 mm of Hg. Among six Indian soybean cultivars tested, Pusa 16 showed highest transformation efficiency of 9.45 %. The transformation efficiency of this method (VIAAT) was higher than previously reported sonication-assisted Agrobacterium-mediated transformation. These results suggest that an efficient Agrobacterium-mediated transformation protocol for stable integration of foreign genes into soybean has been developed.     

USE OF THE SODIUM SALT GLYCOSYLATION HETBOD IN NUCLEOSIDE SYNTHESIS

Abstract

A general and stereospecific method has been developed for the direct preparation of βD-ribofuranosyl, βD-arabinofuranosyl and 2-deoxy-βD-erythro-pentofuranosyl derivatives of a number of nitrogen heterocycles. The azoles thus far employed include appropriately substituted pyrrole, pyrazole, imidazole, 1,2,4-triazole, indole, imidazo[4,5-c]pyridine, pyrrolo[2,3-d]pyrimidine, pyrro10[3,2-c]pyridine, pyrrolo[4,2-c]pyrimidine, purine, pyrazolo[3,4-b]pyridine and pyrazolo-[3,4-d]pyrimidine. This simple high-yield methodology provided a facile route to the large-scale preparation of biologically significant nucleo-sides, such as 2′-deoxyribavirin, 2-chloro-2′-deoxyadenosine, tuber-cidin, Z'-deoxytubercidin, =sangivarnycin, 2′-deoxytoyocamycin, cade-guomycin, 2′-deoxycadeguomycin, G-cadeguomycin, kanagawamicin, 2′-deoxy-3-deazaguanosine, sG, brunfelsarnidine ribonucleoside and 2′-deoxyribofuranosyl derivative of the antibiotic SF-2140. This procedure appears to be considerably superior to the previously reported glycosylation methods.     

Synthesis of Brunfelsamidine Ribonucleoside and Certain Related Compounds by the Stereospecific Sodium Salt Glycosylation Procedure

Abstract

A synthesis of 2,4-dideazaribavirin ( 2 ), brunfelsamidine ribonucleoside ( 8c ) and certain related derivatives are described for the first time using the stereospecific sodium salt glycosylation procedure. Glycosylation of the sodium salt of pyrrole-3-carbonitrile ( 4 ) with 1-chloro-2, 3-O-t-isopropylidene-5-O-t-butyldimethylsilyl-α-D-ribofuranose ( 5 ) gave exclusively the corresponding blocked nucleoside ( 6 ) with β-anomeric configuration, which on deprotection provided 1-β-D-ribofuranosylpyrrole-3-carbonitrile ( 7 ). Functional group tranformation of 7 gave 2 , 8c and related 3-substituted pyrrole ribonucleosides. These compounds are devoid of any significant antiviral/antitumor activity invitro.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Iron Fortification of Banana by the Expression of Soybean Ferritin

Iron deficiency anemia is one of the serious ailments related to nutrition in the developing countries. Fruit and vegetable crops favor the bioavailability of iron. Banana is consumed as a staple food in the tropics. Iron-fortified bananas provide an effective means of controlling the iron deficiency. Embryogenic cells of banana cv. Rasthali (AAB) were transformed with soybean ferritin cDNA using two different expression cassettes pSF and pEFE-SF to express ferritin. Transgenic nature of the regenerated plants was confirmed by PCR. Transgenic plants were regenerated and analyzed through PCR and PCR-Southern analysis. The expression of ferritin was confirmed by RT-PCR. Iron and zinc levels in the transgenic and control plants were estimated by atomic absorption spectroscopy. A 6.32-fold increase in iron accumulation and a 4.58-fold increase in the zinc levels were noted in the leaves of transgenic plants. Thus, iron- and zinc-fortified bananas could be developed as a functional food to overcome the malnutrition-related iron deficiency. This is the first report on the iron and zinc fortification of banana.     

Functional Anatomy of Polycomb and Trithorax Chromatin Landscapes in Drosophila Embryos

Polycomb group (PcG) and trithorax group (trxG) proteins are conserved chromatin factors that regulate key developmental genes throughout development. In Drosophila, PcG and trxG factors bind to regulatory DNA elements called PcG and trxG response elements (PREs and TREs). Several DNA binding proteins have been suggested to recruit PcG proteins to PREs, but the DNA sequences necessary and sufficient to define PREs are largely unknown. Here, we used chromatin immunoprecipitation (ChIP) on chip assays to map the chromosomal distribution of Drosophila PcG proteins, the N- and C-terminal fragments of the Trithorax (TRX) protein and four candidate DNA-binding factors for PcG recruitment. In addition, we mapped histone modifications associated with PcG-dependent silencing and TRX-mediated activation. PcG proteins colocalize in large regions that may be defined as polycomb domains and colocalize with recruiters to form several hundreds of putative PREs. Strikingly, the majority of PcG recruiter binding sites are associated with H3K4me3 and not with PcG binding, suggesting that recruiter proteins have a dual function in activation as well as silencing. One major discriminant between activation and silencing is the strong binding of Pleiohomeotic (PHO) to silenced regions, whereas its homolog Pleiohomeotic-like (PHOL) binds preferentially to active promoters. In addition, the C-terminal fragment of TRX (TRX-C) showed high affinity to PcG binding sites, whereas the N-terminal fragment (TRX-N) bound mainly to active promoter regions trimethylated on H3K4. Our results indicate that DNA binding proteins serve as platforms to assist PcG and trxG binding. Furthermore, several DNA sequence features discriminate between PcG- and TRX-N–bound regions, indicating that underlying DNA sequence contains critical information to drive PREs and TREs towards silencing or activation.     

Effects of Protease,Phytase and a Bacillus sp. Direct-Fed Microbial on Nutrient and Energy Digestibility,Ileal Brush Border Digestive Enzyme Activity and Cecal Short-Chain Fatty Acid Concentration in Broiler Chickens

Two experiments were conducted to determine the effects of protease and phytase (PP) and a Bacillus sp. direct-fed microbial (DFM) on dietary energy and nutrient utilization in broiler chickens. In the first experiment, Ross 308 broiler chicks were fed diets supplemented with PP and DFM in a 2×2 factorial arrangement. The 4 diets (control (CON), CON + PP, CON + DFM, and CON + PP + DFM) were fed from 15–21 days of age. In Experiment 1, significant interaction (P≤0.01) between PP and DFM on the apparent ileal digestibility coefficient for starch, crude protein, and amino acid indicated that both additives increased the digestibility. Both additives increased the nitrogen retention coefficient with a significant interaction (P≤0.01). Although no interaction was observed, significant main effects (P≤0.01) for nitrogen-corrected apparent ME (AMEn) for PP or DFM indicated an additive response. In a follow-up experiment, Ross 308 broiler chicks were fed the same experimental diets from 1–21 days of age. Activities of ileal brush border maltase, sucrase, and L-alanine aminopeptidase were increased (P≤0.01) by PP addition, while a trend (P = 0.07) for increased sucrase activity was observed in chickens fed DFM, in Experiment 2. The proportion of cecal butyrate was increased (P≤0.01) by DFM addition. Increased nutrient utilization and nitrogen retention appear to involve separate but complementary mechanisms for PP and DFM, however AMEn responses appear to have separate and additive mechanisms.     

AgNO3 boosted high-frequency shoot regeneration in Vigna mungo (L.) Hepper

In order to further increase shoot regeneration frequency of Vigna mungo (L.) Hepper., the effects of AgNO₃ on this process was investigated in this study. The shoot tip and cotyledonary node explants were cultured on MS salts B5 Vitamins medium containing BA+TDZ+Ads+AgNO₃ for multiple shoot induction. AgNO₃ influenced the shoot bud formation and their subsequent proliferation. The best medium composition for multiple shoot induction was BA, TDZ combination with Ads and AgNO₃ in MSB5 medium. Maximum 39 shoots in cotyledonary node and 22 shoots in shoot tip were obtained per explants after 4 – 6 wk. of culture. Elongation and rooting were performed in GA₃ (0.6mg/l) and IBA (0.4mg/L) containing media respectively. The in vitro raised plantlets were acclimatized in green house and successfully transplanted to the field with a survival rate of 78%.     

Synthesis and Characterization of Polysialic Acid–Uricase Conjugates for the Treatment of Hyperuricemia

Uricase, an enzyme used for the treatment of hyperuricemia, is conjugated with polysialic acid (PSA) of average molecular weight of 10 kDa by reductive amination in presence of NaCNBH3 in order to improve its pharmacological properties. Polysialylation with 50-,100-,150- and 200-fold molar excess of PSA increased the percentage substitution of the free amino groups on enzyme surface (46, 66, 78 and 80 % respectively). The SDS-PAGE is used to visualize the conjugates with increased molecular weight and it retained almost 65 % of their initial specific activity after conjugation. The stability studies at physiological condition reveals improved stability and activity than the native enzyme. The apparent KM of the enzyme has increased slightly from 4.18 × 10^?5 M to 5.46 × 10^?5 M suggesting that the affinity of the substrate to the enzyme has not been altered to a higher extent. The conjugates, when probed against anti-uricase antibodies generated in rabbit, showed a clean decline in the affinity by 35 % and also have retained double the catalytic activity than that of the native enzyme after exposure to antiserum. The results suggest that uricase-PSA conjugates can be used as an alternative to the conventional synthetic polymer-enzyme conjugates.