Genetic mapping of meander tail, a mouse mutation affecting cerebellar development

The meander tail mouse harbors a recessive mutation on chromosome 4 that affects the anterior lobes of the cerebellum and the caudal vertebrae. Examination of the mea/mea cerebellum reveals that the complete disorganization of all cell types seen in the anterior lobes is separated by a sharp and consistent boundary from the normal cytoarchitecture of the posterior lobes. In the absence of any biochemical information regarding the affected gene product, attempts to clone the gene must rely on the strategy of reverse genetics. As an initial step in this process we have constructed a genetic linkage map spanning 68 cM of chromosome 4 using an intersubspecific phenotypic backcross. The loci included in this analysis are Calb, Ggtb, Lv, b, Ifa, mea, D4Rp1, Glut-1, Lck, Lmyc-1, and Eno-1. This analysis positions the mea phenotypic locus in the interval between Ifa and Glut1. These results also further define regions of homology between mouse chromosome 4 and human chromosomes 8, 1, and 9. This linkage map provides the means to evaluate candidate genes, and to identify tightly linked markers useful for cloning the meander tail locus.     

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.     

Arabidopsis ERG28 Tethers the Sterol C4-Demethylation Complex to Prevent Accumulation of a Biosynthetic Intermediate That Interferes with Polar Auxin Transport

Sterols are vital for cellular functions and eukaryotic development because of their essential role as membrane constituents. Sterol biosynthetic intermediates (SBIs) represent a potential reservoir of signaling molecules in mammals and fungi, but little is known about their functions in plants. SBIs are derived from the sterol C4-demethylation enzyme complex that is tethered to the membrane by Ergosterol biosynthetic protein28 (ERG28). Here, using nonlethal loss-of-function strategies focused on Arabidopsis thaliana ERG28, we found that the previously undetected SBI 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC) inhibits polar auxin transport (PAT), a key mechanism by which the phytohormone auxin regulates several aspects of plant growth, including development and responses to environmental factors. The induced accumulation of CMMC in Arabidopsis erg28 plants was associated with diagnostic hallmarks of altered PAT, including the differentiation of pin-like inflorescence, loss of apical dominance, leaf fusion, and reduced root growth. PAT inhibition by CMMC occurs in a brassinosteroid-independent manner. The data presented show that ERG28 is required for PAT in plants. Furthermore, it is accumulation of an atypical SBI that may act to negatively regulate PAT in plants. Hence, the sterol pathway offers further prospects for mining new target molecules that could regulate plant development.     

Case Studies of the Impacts of Cataract Surgery on Crested Penguin Welfare

As nonhuman animals age, geriatric individuals require additional care and veterinary support to ensure their well being. The focus on lifelong care is a relatively newer approach when providing good welfare, and few studies have examined how veterinary care impacts behavior at different ages or how best to accommodate geriatric individuals in zoos. The objectives of this study were to (a) assess both the immediate and long-term (one year later) behavioral impacts of cataract removal for macaroni (Eudyptes chrysolophus) and southern rockhopper (Eudyptes chrysocome) penguins; (b) compare the behavior of penguins following cataract surgery to that of other conspecifics in the same habitat; and (c) monitor the impacts of cataract surgery on swimming behavior using time-depth recorders. Individual responses to cataract removal differed in direction and magnitude, and these mixed results highlight that welfare is experienced and thus measured at the individual level. Positive responses included increased habitat use, increased time spent swimming, and increased rates of affiliative interactions. This study highlights the importance of assessing welfare impacts of veterinary interventions on geriatric individuals.     

Methods for studying cultural attraction

Cultural attraction theory (CAT) describes a general evolutionary process, cultural attraction, by which the spread and stability of cultural items (beliefs, practices, artifacts, etc.) result not just from differential reproduction, but also from transformations that systematically favor the reconstruction of cultural items of specific types. In this way, CAT aims to provide a general framework for the study of cultural evolution. In a thoughtful critical analysis, Buskell questions the ability of CAT to provide methodological guidance for research in cultural evolution. Can CAT be used to develop the sort of mid‐range theories and models that often drive empirical work? Here we argue that CAT can indeed be used in this way, and we outline the methodological practices that students of cultural attraction have used and are currently developing.     

The Detection of Hamster Connexins: A Comparison of Expression Profiles with Wild-Type Mouse and the Cancer-Prone Min Mouse

The open reading frames of 17 connexins from Syrian hamster (using tissues) and 16 connexins from the Chinese hamster cell line V79, were fully (Cx30, Cx31, Cx37, Cx43 and Cx45) or partially sequenced. We have also detected, and partially sequenced, seven rat connexins that previously were unavailable. The expression of connexin genes was examined in some hamster organs and cultured hamster cells, and compared with wild-type mouse and the cancer-prone Min mouse. Although the expression patterns were similar for most organs and connexins in hamster and mouse, there were also some prominent differences (Cx29 and 30.3 in testis; Cx31.1 and 32 in eye; Cx46 in brain, kidney and testis; Cx47 in kidney). This suggests that some connexins have species-specific expression profiles. In contrast, there were minimal differences in expression profiles between wild type and Min mice. Species-specific expression profiles should be considered in attempts to make animal models of human connexin-associated diseases.     

Diversification of sterol methyltransferase enzymes in plants and a role for β‐sitosterol in oriented cell plate formation and polarized growth

Phytosterols are classified into C24‐ethylsterols and C24‐methylsterols according to the different C24‐alkylation levels conferred by two types of sterol methyltransferases (SMTs). The first type of SMT (SMT1) is widely conserved, whereas the second type (SMT2) has diverged in charophytes and land plants. The Arabidopsis smt2 smt3 mutant is defective in the SMT2 step, leading to deficiency in C24‐ethylsterols while the C24‐methylsterol pathway is unchanged. smt2 smt3 plants exhibit severe dwarfism and abnormal development throughout their life cycle, with irregular cell division followed by collapsed cell files. Preprophase bands are occasionally formed in perpendicular directions in adjacent cells, and abnormal phragmoplasts with mislocalized KNOLLE syntaxin and tubulin are observed. Defects in auxin‐dependent processes are exemplified by mislocalizations of the PIN2 auxin efflux carrier due to disrupted cell division and failure to distribute PIN2 asymmetrically after cytokinesis. Although endocytosis of PIN2–GFP from the plasma membrane (PM) is apparently unaffected in smt2 smt3, strong inhibition of the endocytic recycling is associated with a remarkable reduction in the level of PIN2–GFP on the PM. Aberrant localization of the cytoplasmic linker associated protein (CLASP) and microtubules is implicated in the disrupted endocytic recycling in smt2 smt3. Exogenous C24‐ethylsterols partially recover lateral root development and auxin distribution in smt2 smt3 roots. These results indicate that C24‐ethylsterols play a crucial role in division plane determination, directional auxin transport, and polar growth. It is proposed that the divergence of SMT2 genes together with the ability to produce C24‐ethylsterols were critical events to achieve polarized growth in the plant lineage.     

Endocrine Disrupting Compounds Alter Risk‐Taking Behavior in Guppies (Poecilia reticulata)

Endocrine disrupting compounds (EDCs) enter aquatic habitats from a variety of anthropogenic sources and can mimic, block, or modulate the synthesis of natural hormones. EDCs affect both reproductive and non‐reproductive behaviors because hormones mediate responses associated with aggression and fear. We examined the effects of two EDCs on risk‐taking behaviors in guppies (Poecilia reticulata). We quantified risk‐taking in terms of propensity to forage in a risky location and tendency to join groups in the presence of a predator. We found that male and female guppies responded oppositely to environmentally relevant concentrations of an estrogenic EDC, 17α‐ethinylestradiol (EE2), or an androgenic EDC, 17β‐trenbolone (TB). Males decreased risk‐taking with increasing EE2 concentration (as predicted), but females increased risk‐taking (contrary to prediction). In contrast, females increased risk‐taking with increasing TB concentrations (as predicted), but males decreased risk‐taking (contrary to prediction). These results did not match our expectation that EE2 would reduce risk‐taking and TB would increase risk‐taking in both sexes. We suspect EE2 and TB produced these counterintuitive effects by downregulating their corresponding hormone receptors and thus reducing levels of circulating endogenous hormones in females and males, respectively. These results show that EDCs can alter fish behavior and potentially reduce fitness in unexpected ways.