排序方式: 共有477条查询结果,搜索用时 15 毫秒
1.
AbstractA study was undertaken to compare the patterns of spatial variability, epiphytic percentage cover, and distribution of epiphytic fauna and flora between the two adjacent seagrasses Cymodocea nodosa and the invasive species Halophila stipulucea. Samples were taken at six stations separated by 600?m and exposed to different current conditions. The stations G2 and G5 were affected by a high current tide, while G4 was directly exposed to the northern marine currents. The station G3 was situated in the middle of a Posidonia oceanica bed and was less exposed to hydrodynamism, whereas the other stations were relatively protected. Results indicate that for both H. stipulacea and C. nodosa, shoot density and epiphytic cover biomass decreased when exposed to high levels of hydrodynamic activity. In terms of epiphytic leaf assemblages, our results showed significant differences for the two host plants in their mean cover and for the six stations at the largest and smallest spatial scale. Our observations highlight the dominance of Rhodophyta and the low number of epiphytic species and the epiphytic cover on H. stipulacea compared to C. nodosa. In addition, results indicate the absence of two taxa Hydrozoans and Annelida in the epiphytic assemblage of H. stipulacea leaves. 相似文献
2.
Aurélien Sokal Pascal Chappert Giovanna Barba-Spaeth Anais Roeser Slim Fourati Imane Azzaoui Alexis Vandenberghe Ignacio Fernandez Annalisa Meola Magali Bouvier-Alias Etienne Crickx Asma Beldi-Ferchiou Sophie Hue Laetitia Languille Marc Michel Samia Baloul France Noizat-Pirenne Marine Luka Matthieu Mahévas 《Cell》2021,184(5):1201-1213.e14
3.
Masood Badri Guang Yang Karima Al Mazroui Jihad Mohaidat Asma Al Rashedi Najwa Al Housani 《Journal of biological education》2017,51(2):166-185
This study employed the international Relevance of Science Education questionnaire to survey the interest in biology and the out-of-school experiences of Abu Dhabi secondary school students (median age 17, mean age 17.53 and mode age of 16) in the third semester of 2014. It included 3100 participants. An exploratory factor analysis was used to categorise the items for both interest in biology and out-of-school experience. Ten interest in biology and 12 out-of-school experience factors were extracted. The summated means for each factor indicated that ‘health and fitness’ and ‘disease control’ enjoyed highest interests among students. For out-of-school experiences, the two factors of ‘digital applications’ and ‘medical treatment’ received the highest scores. Multivariate analysis of variance revealed that all factors for both interest in biology and out-of-school experience exhibited significant differences between boys and girls. More girls than boys were interested in disease control, reproduction (human biology), alternative science, health and fitness, zoology, and applied cosmetic biology. No significant differences were observed for the remaining five other categories. Furthermore, analysis of variance revealed significant differences between boys and girls with regard to individual items comprising each of the factors. The highest correlations were between the two factors of out-of-school experiences of ‘the natural world’ and ‘learning through observation’ and the interest in biology factor related to ‘plant and animal farming and agriculture’. Results suggested that more emphasis must be placed on students’ out-of-school experience and their engagement in informal learning in contextual outdoor environments to enhance their interest in learning more about biology and the living environment in general. 相似文献
4.
Adriana Simionescu-Bankston Giovanna Leoni Yanru Wang Peter P. Pham Arivudainambi Ramalingam James B. DuHadaway Victor Faundez Asma Nusrat George C. Prendergast Grace K. Pavlath 《Developmental biology》2013
Actin dynamics are necessary at multiple steps in the formation of multinucleated muscle cells. BAR domain proteins can regulate actin dynamics in several cell types, but have been little studied in skeletal muscle. Here, we identify novel functions for the N-BAR domain protein, Bridging integrator 3 (Bin3), during myogenesis in mice. Bin3 plays an important role in regulating myofiber size in vitro and in vivo. During early myogenesis, Bin3 promotes migration of differentiated muscle cells, where it colocalizes with F-actin in lamellipodia. In addition, Bin3 forms a complex with Rac1 and Cdc42, Rho GTPases involved in actin polymerization, which are known to be essential for myotube formation. Importantly, a Bin3-dependent pathway is a major regulator of Rac1 and Cdc42 activity in differentiated muscle cells. Overall, these data classify N-BAR domain proteins as novel regulators of actin-dependent processes in myogenesis, and further implicate BAR domain proteins in muscle growth and repair. 相似文献
5.
Asma Hatoum-Aslan Poulami Samai Inbal Maniv Wenyan Jiang Luciano A. Marraffini 《The Journal of biological chemistry》2013,288(39):27888-27897
Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation. 相似文献
6.
Five different types of pollen tetrads were detected from the short and long stamens of the male and hermaphrodite flowers of the androdioecious species, Mimosa pigra L. Light (LM) and scanning electron microscopes (SEM) were used in this study to redescribe the pollen forms and to identify the various pollen types encountered. An identification key and relative percentages of these pollen types were also presented. The study showed that the long stamens of the male flowers and those of the hermaphrodite ones have five (I, II, III, IV and V) and two (I and V) pollen types respectively, whereas the short stamens of both male and hermaphrodite flowers have only one pollen type (type I). We report here the first incidence of intra‐specific pollen polymorphism in androdioecious species. 相似文献
7.
Naiara Akizu Nuri?M. Shembesh Tawfeg Ben-Omran Laila Bastaki Asma Al-Tawari Maha?S. Zaki Roshan Koul Emily Spencer Rasim?Ozgur Rosti Eric Scott Elizabeth Nickerson Stacey Gabriel Gilberto da?Gente Jiang Li Matthew?A. Deardorff Laura?K. Conlin Margaret?A. Horton Elaine?H. Zackai Elliott?H. Sherr Joseph?G. Gleeson 《American journal of human genetics》2013,92(3):392-400
The corpus callosum is the principal cerebral commissure connecting the right and left hemispheres. The development of the corpus callosum is under tight genetic control, as demonstrated by abnormalities in its development in more than 1,000 genetic syndromes. We recruited more than 25 families in which members affected with corpus callosum hypoplasia (CCH) lacked syndromic features and had consanguineous parents, suggesting recessive causes. Exome sequence analysis identified C12orf57 mutations at the initiator methionine codon in four different families. C12orf57 is ubiquitously expressed and encodes a poorly annotated 126 amino acid protein of unknown function. This protein is without significant paralogs but has been tightly conserved across evolution. Our data suggest that this conserved gene is required for development of the human corpus callosum. 相似文献
8.
Mehwish Iqtedar Mehral Aslam Muhammad Akhyar Asma Shehzaad Roheena Abdullah Afshan Kaleem 《Preparative biochemistry & biotechnology》2013,43(2):136-142
AbstractBiosynthesis of metal nanoparticles is an area of interest among researchers because of its eco-friendly approach. Current study focuses at biosynthesis of silver nanoparticles (AgNPs) and optimization of physico-chemical conditions to obtain mono-dispersed and stable AgNPs having antimicrobial activity. Initially Bacillus mojavensis BTCB15 produced silver nanoparticles (AgNPs) of 105?nm. Silver nanoparticles (AgNPs) were characterized by particle size analyzer, UV-Vis Spectroscopy, Fourier transforms infrared spectroscopy (FTIR), Atomic force microscopy (AFM), and X-ray diffraction (XRD). Whereas, under optimal conditions of temperature 55?°C, pH 8, addition of surfactant Tween 20, and metal ion K2SO4, about 104% size reduction was achieved with average size of 2.3nm. Molecular characterization revealed 98% sequence homology with Bacillus mojavensis. AgNPs exhibited antibacterial activity at concentrations ranging from 0.5 to 2.5?µg/µl against Escherichia coli BTCB03, Klebsiella pneumonia BTCB04, Acinetobacter sp. BTCB05, and Pseudomonas aeruginosa BTCB01 but none against Staphylococcus aureus BTCB02. Highest antibacterial activity was observed at 0.27?µg/µl and lowest at 0.05?µg/µl of AgNPs indicated by zone of inhibition. Conclusively, under optimum conditions, Bacillus mojavensis BTCB15 was able to produce AgNPs of 2.3?nm size and had antibacterial activity against multi drug resistant pathogens. 相似文献
9.
Urmila Saha Asma Yasmeen Khan Sutanwi Bhuiya Suman Das Gaetano Fiorillo Paolo Lombardi 《Journal of biomolecular structure & dynamics》2019,37(6):1375-1389
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M?1, and that of BER was (0.98 ± 0.03) × 105 M?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands. 相似文献
10.
Asma Fethia Ghenim Madani Benyoucef Gamal El Qot Mohammed Adaci Mustapha Bensalah 《Annales de Paléontologie》2019,105(1):21-38
The Upper Cretaceous rocks are widely distributed and well exposed in south Algeria and consist in beds rich in macrofauna. For the first time, twenty veneroid species (Bivalvia) are systematically described from the upper Cenomanian deposits of the Guir Basin. While three species were reported since long before [Granocardium desvauxi (Coquand), G. productum (J. de C. Sowerby) and Glossus aquilinus (Coquand)]; Lucina fallax Forbes, Crassatella (Rochella) tenuicostata (Seguenza), Protocardia hillana (J. Sowerby), G. productum (J. de C. Sowerby) var. byzacenica (Pervinquière), Arctica cordata (Sharpe), A. humei (Cox), A. inornata (d’Orbigny), A. picteti (Coquand), Tenea delettrei (Coquand), Paraesa faba (J. de C. Sowerby), Meretrix desvauxi (Coquand) were previously unknown from the Cretaceous of Algerian Sahara. Because of reduced degree of preservation, Sphaera cf. corrugata J. Sowerby, Maghrebella cf. forgemoli (Coquand), Maghrebella sp., Granocardium cf. carolinum (d’Orbigny), Protocardia sp. and Meretrix sp. are tentatively determined. The studied material, found in the lower part of the “Calcaires de Sidi Mohamed Ben Bouziane” Formation, evidences palaeobiogeographic affinities occurring over a wide geographical area: from North Africa, southern Europe to Middle East and India. The present study provides new information to the knowledge of the upper Cenomanian palaeobiology of the studied region. 相似文献