A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Changes in the Activity of the Maturation-Promoting Factor Are Correlated with Those of a Major Cyclic AMP and Calcium-Independent Protein Kinase During the First Mitotic Cell Cycles in the Early Starfish Embryo

Many studies suggest that MPF activation depends on protein phosphorylation or that MPF is itself a protein kinase. In the present report, cyclic variations of MPF activity have been correlated in vivo with changes in the extent of protein phosphorylation or in vitro with changes of a major protein kinase during the first cell cycles of fertilized starfish eggs. This cycling protein kinase neither requires cAMP nor Ca²⁺. Neither colchicine nor aphidicoline, which inhibits cleavage and chromosome replication respectively, was found to suppress the synchronous and cyclic variations of both MPF and protein kinase activities. Protein synthesis was found to be required for both MPF and protein kinase activities to reappear after their simultaneous drop at the time of mitotic or meiotic cleavages. Production of either MPF or protein kinase activities is not the immediate result of protein synthesis since there is a delay at each cell cycle between the time when protein synthesis is required and the time when both MPF and protein kinase activities are produced. This suggests that both MPF and protein kinase activities might involve some post-translational modification of a precursor protein synthesized during the preceeding cell cycle.     

Nanoplanktonic coccolithophorids (Prymnesiophyceae, Haptophyceae) from the Weddell Sea, Antarctica

The examination of whole mounts prepared for transmission electron microscopy has resulted in the finding of thirteen taxa of nanoplanktonic coccolithophorids from the Weddell Sea, Antarctica. The material was collected as part of the AMERIEZ programme, March 1986. Cold-water adapted nanoplanktonic coccolithophorids have previously been shown to constitute a recurrent plankton element at subarctic and arctic localities. Three of the Weddell Sea species, Wigwamma annulifera, W. arctica , and Papposphaera sagittifera , are conspecific with northern hemisphere material, while two species, Calciarcus alaskensis and Turrisphaera arctica , are possibly identical with previously described arctidsubarctic material. Six taxa new to science have been described from the Weddell Sea, Wigwamma antarctica, W. triradiata, Trigonaspis melvillea, Pappomonas weddellensis, Papposphaera obpyramidalis , and P. simplicissima . The cooccurrence of identical forms at the two poles, and the fact that the species described are allocated to "arctic" genera, indicate a geologically relatively recent exchange of biological material between the poles.     

Active human tissue plasminogen activator secreted from insect cells using a baculovirus vector

A baculovirus expression vector was constructed with the tissue plasminogen activator (TPA) cDNA under the control of the viral polyhedrin promoter. After infection of insect cells with the recombinant baculovirus, active TPA was secreted into the medium in which these cells were grown. TPA was isolated from the conditioned media using metal chelate affinity chromatography followed by immunoaffinity purification using mouse monoclonal anti-human TPA coupled to Sepharose. Sodium dodecyl sulfate-gel electrophoresis under reducing conditions and sequence analysis of recombinant human TPA have revealed a two-chain form of the enzyme. The N-terminal amino acid was identified to be serine, indicating that it was processed at its N-terminus by the insect cell culture in a manner similar to that observed for mammalian cells. The relative specific activity of recombinant TPA from insect cells is comparable to that of Bowes melanoma TPA standard. Its activity is stimulated in the presence of fibrinogen fragments, but by a factor about 2.3-fold lower than the Bowes melanoma TPA. The apparent molecular weight of recombinant TPA from insect cells was about 60K by fibrin agar activity gels, suggesting less complex glycosylation than recombinant TPA from mammalian cells.