Larvae of Euphausia superba in the Scotia Sea and Bransfield Strait in March 1984 — Development and abundance compared with 1981 larvae

Summary Larvae of Euphausia superba in the Atlantic sector of the Antarctic in March 1984 averaged 580 per 1000 m³ of water. This is 100 times less than we observed in March 1981, but more than the average of 250 larvae per 1000 m³ found in January–February 1981. There was one 1984 high-abundance sample, accounting for 85% of all larvae caught, from the eastern area of confluence of Drake Passage and Weddell Sea waters. Abundances in 1984 near the South Shetland Islands were commonly 5 to 10 larvae per 1000 m³, and younger by 2 to 4 developmental stages than in March 1981. Body lengths of given stages were generally less in 1984 than in 1981. Advanced furcilia stages, particularly, in the 1984 samples tended to be smaller than the same stages in March 1981, indicating relatively poor growth during February 1984. However, the 1984 younger larvae (calyptopes and the developmental forms of furcilia stages 1 and 2) indicated that, in 1984, recent (March) growth had been good — probably better than in February. Dierct observation of the development of calyptopis stage 3 to furcilia stage yielded a development time of 7.7 days, which compares favorably to the 8-day period estimated from field samples. Reduced food availability did not affect the development rate nor give rise to a clearly higher incidence of indirect pathways of development. It is postulated that recruitment was about of month later in 1984 than in 1981 in most of the area studied and was probably going to be less successful.     

Histology and fine structure of spermatozoa and egg passage in the female tract of Dermacentro andersoni stiles (acari-Ixodidae)

The final phase of spermiogenesis in the hard tick Dermacentor andersoni occurs in the seminal receptacle of engorged females. This phase is characterized mainly by rupture of the outer sheath of advanced spermatids at their pointed tips, and subsequent elongation as the internal column of these cells evaginates. The sheath invaginates at the opposite end to form the narrow posterior half of the sperm cell. Rupture of the endospermatophoric wall releases the large mass of contained spermatozoa, which begin migration up one or both oviducts. During the migration to the ovarian lumen, spermatozoa exhibit a propensity for active penetration of epithelial cells lining the oviducts. This phenomenon is also observed with spermatozoa in the ovarian lumen. Penetration of epithelial cells by spermatozoa is interpreted to be a response by the latter in seeking eggs for penetration and fertilization.     

Cell proteins bind specifically to West Nile virus minus-strand 3' stem-loop RNA.

The first 96 nucleotides of the 5'noncoding region (NCR) of West Nile virus (WNV) genomic RNA were previously reported to form thermodynamically predicted stem-loop (SL) structures that are conserved among flaviviruses. The complementary minus-strand 3' NCR RNA, which is thought to function as a promoter for the synthesis of plus-strand RNA, forms a corresponding predicted SL structure. RNase probing of the WNV 3' minus-strand stem-loop RNA [WNV (-)3' SL RNA] confirmed the existence of a terminal secondary structure. RNA-protein binding studies were performed with BHK S100 cytoplasmic extracts and in vitro-synthesized WNV (-)3' SL RNA as the probe. Three RNA-protein complexes (complexes 1,2, and 3) were detected by a gel mobility shift assay, and the specificity of the RNA-protein interactions was confirmed by gel mobility shift and UV-induced cross-linking competition assays. Four BHK cell proteins with molecular masses of 108, 60, 50, and 42 kDa were detected by UV-induced cross-linking to the WNV (-)3' SL RNA. A preliminary mapping study indicated that all four proteins bound to the first 75 nucleotides of the WNV 3' minus-strand RNA, the region that contains the terminal SL. A flavivirus resistance phenotype was previously shown to be inherited in mice as a single, autosomal dominant allele. The efficiencies of infection of resistant cells and susceptible cells are similar, but resistant cells (C3H/RV) produce less genomic RNA than congenic, susceptible cells (C3H/He). Three RNA-protein complexes and four UV-induced cross-linked cell proteins with mobilities identical to those detected in BHK cell extracts with the WNV (-)3' SL RNA were found in both C3H/RV and C3H/He cell extracts. However, the half-life of the C3H/RV complex 1 was three times longer than that of the C3H/He complex 1. It is possible that the increased binding activity of one of the resistant cell proteins for the flavivirus minus-strand RNA could result in a reduced synthesis of plus-strand RNA as observed with the flavivirus resistance phenotype.     

Bovine fetal anoxia observed in pregnant beef heifers experimentally inoculated with Anaplasma marginale

Six heifers in the third trimester of gestation were inoculated with Anaplasma marginale carrier blood. Laparohysterotomies were performed under local anesthesia at varying stages of anemia induced by anaplasmosis and the placental blood gas exchange was examined. Laparohysterotomies were similarly performed on three uninoculated control heifers and the placental blood gas exchange compared to the fetuses recovered from anemic (inoculated) heifers. Blood samples from the dam and fetus were recovered at the time of surgery and arterial blood gases and pH determined. A decline in fetal oxygen tension accompanied the maternal anemia. The evidence suggests that third trimester fetal death in heifers experimentally inoculated with Anaplasma marginale is due to fetal anoxia.     

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.     

Augmenting Endogenous Wnt Signaling Improves Skin Wound Healing

Wnt signaling is required for both the development and homeostasis of the skin, yet its contribution to skin wound repair remains controversial. By employing Axin2^LacZ/+ reporter mice we evaluated the spatial and temporal distribution patterns of Wnt responsive cells, and found that the pattern of Wnt responsiveness varies with the hair cycle, and correlates with wound healing potential. Using Axin2^LacZ/LacZ mice and an ear wound model, we demonstrate that amplified Wnt signaling leads to improved healing. Utilizing a biochemical approach that mimics the amplified Wnt response of Axin2^LacZ/LacZ mice, we show that topical application of liposomal Wnt3a to a non-healing wound enhances endogenous Wnt signaling, and results in better skin wound healing. Given the importance of Wnt signaling in the maintenance and repair of skin, liposomal Wnt3a may have widespread application in clinical practice.     

Recent changes in endometrial cancer trends among menopausal-age US women

BackgroundChanges in endometrial cancer incidence rates after the precipitous decline in menopausal hormone therapy (MHT) use in 2002 have not been evaluated.MethodsUsing data from the Surveillance, Epidemiology, and End Results Program from 1992 to 2009 (SEER 13), we identified 63 428 incident endometrial cancer cases among women ages 20–74. We compared annual percent change (APC) in endometrial cancer incidence rates from 1992 to 2002 to rates from 2003 to 2009.ResultsIn contrast to the constant endometrial cancer rate pattern observed from 1992 to 2002 (APC 0.0%), rates increased after 2002 in women 50–74 years old (2.5%; P_{APC comparison} < 0.01). Endometrial cancer incidence increased over the entire time period among women ages 20–49 (1992–2002: 1.1%; 2003–2009: 2.1%; P_{APC comparison} = 0.21). Post-2002 increases in incidence among women ages 50–74 were specific to Type I endometrial tumors (1992–2002: ?0.6%; 2003–2009: 1.6%; P_{APC comparison} < 0.01).DiscussionThe increase in endometrial cancer incidence rates after 2002 may be related to the widespread decrease in estrogen plus progestin MHT use, which has been reported to lower endometrial cancer risk in overweight and obese women.     

Age-Dependent Modulation of Synaptic Plasticity and Insulin Mimetic Effect of Lipoic Acid on a Mouse Model of Alzheimer’s Disease

Alzheimer’s disease is a progressive neurodegenerative disease that entails impairments of memory, thinking and behavior and culminates into brain atrophy. Impaired glucose uptake (accumulating into energy deficits) and synaptic plasticity have been shown to be affected in the early stages of Alzheimer’s disease. This study examines the ability of lipoic acid to increase brain glucose uptake and lead to improvements in synaptic plasticity on a triple transgenic mouse model of Alzheimer’s disease (3xTg-AD) that shows progression of pathology as a function of age; two age groups: 6 months (young) and 12 months (old) were used in this study. 3xTg-AD mice fed 0.23% w/v lipoic acid in drinking water for 4 weeks showed an insulin mimetic effect that consisted of increased brain glucose uptake, activation of the insulin receptor substrate and of the PI3K/Akt signaling pathway. Lipoic acid supplementation led to important changes in synaptic function as shown by increased input/output (I/O) and long term potentiation (LTP) (measured by electrophysiology). Lipoic acid was more effective in stimulating an insulin-like effect and reversing the impaired synaptic plasticity in the old mice, wherein the impairment of insulin signaling and synaptic plasticity was more pronounced than those in young mice.     

Polymorphism in NOD2, Crohn's disease, and susceptibility to pulmonary tuberculosis

The nucleotide oligomerization binding domain 2 gene (NOD2) encodes an intracellular receptor for bacterial components, which is expressed in monocytes and is associated with Crohn's Disease (CD). This finding, along with epidemiological evidence, supports a role for infection in the pathogenesis of CD. Speculation that mycobacteria are involved in CD led us to investigate NOD2 in susceptibility to tuberculosis (TB), a global public health problem caused by Mycobacterium tuberculosis. CD-associated NOD2 variants were absent in a case-control study of 640 Gambians, where CD is rare. Novel NOD2 promoter polymorphisms were identified but showed no association with TB in this African population sample.