A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Mutational analysis of the Bradyrhizobium japonicum common nod genes and further nod box-linked genomic DNA regions

Summary By insertional and deletional marker replacement mutagenesis the common nod region of Bradyrhizobium japonicum was examined for the presence of additional, essential nodulation genes. An open reading frame located in the 800 bp large intergenic region between nodD1 and nodA did not appear to be essential for nodulation of soybean. Furthermore, a strain with a deletion of the nodI- and nodJ-like genes downstream of nodC had a Nod⁺ phenotype. A mutant with a 1.7 kb deletion immediately downstream of nodD1 considerably delayed the onset of nodulation. This region carried a second copy of nodD (nodD2). A nodD1-nodD2 double mutant had a similar phenotype to the nodD2 mutant. Using a 22-mer oligonucleotide probe partially identical to the nod box sequence, a total of six hybridizing regions were identified in B. japonicum genomic DNA and isolated from a cosmid library. Sequencing of the hybridizing regions revealed that at least three of them represented true nod box sequences whereas the others showed considerable deviations from the consensus sequence. One of the three nod box sequences was the one known to be associated with nodA, whereas the other two were located 60 to 70 kb away from nif cluster I. A deletion of one of these two sequences plus adjacent DNA material mmutant 308) led to a reduced nodulation on Vigna radiata but not on soybean. Thus, this region is probably involved in the determination of host specificity.Dedicated to Prof. Giorgio Semenza on the occasion of his 60th birthday     

Nanoplanktonic coccolithophorids (Prymnesiophyceae, Haptophyceae) from the Weddell Sea, Antarctica

The examination of whole mounts prepared for transmission electron microscopy has resulted in the finding of thirteen taxa of nanoplanktonic coccolithophorids from the Weddell Sea, Antarctica. The material was collected as part of the AMERIEZ programme, March 1986. Cold-water adapted nanoplanktonic coccolithophorids have previously been shown to constitute a recurrent plankton element at subarctic and arctic localities. Three of the Weddell Sea species, Wigwamma annulifera, W. arctica , and Papposphaera sagittifera , are conspecific with northern hemisphere material, while two species, Calciarcus alaskensis and Turrisphaera arctica , are possibly identical with previously described arctidsubarctic material. Six taxa new to science have been described from the Weddell Sea, Wigwamma antarctica, W. triradiata, Trigonaspis melvillea, Pappomonas weddellensis, Papposphaera obpyramidalis , and P. simplicissima . The cooccurrence of identical forms at the two poles, and the fact that the species described are allocated to "arctic" genera, indicate a geologically relatively recent exchange of biological material between the poles.     

Active human tissue plasminogen activator secreted from insect cells using a baculovirus vector

A baculovirus expression vector was constructed with the tissue plasminogen activator (TPA) cDNA under the control of the viral polyhedrin promoter. After infection of insect cells with the recombinant baculovirus, active TPA was secreted into the medium in which these cells were grown. TPA was isolated from the conditioned media using metal chelate affinity chromatography followed by immunoaffinity purification using mouse monoclonal anti-human TPA coupled to Sepharose. Sodium dodecyl sulfate-gel electrophoresis under reducing conditions and sequence analysis of recombinant human TPA have revealed a two-chain form of the enzyme. The N-terminal amino acid was identified to be serine, indicating that it was processed at its N-terminus by the insect cell culture in a manner similar to that observed for mammalian cells. The relative specific activity of recombinant TPA from insect cells is comparable to that of Bowes melanoma TPA standard. Its activity is stimulated in the presence of fibrinogen fragments, but by a factor about 2.3-fold lower than the Bowes melanoma TPA. The apparent molecular weight of recombinant TPA from insect cells was about 60K by fibrin agar activity gels, suggesting less complex glycosylation than recombinant TPA from mammalian cells.     

The regulatory status of the fixL- and fixJ-like genes in Bradyrhizobium japonicum may be different from that in Rhizobium meliloti

Summary The cloning, sequencing and mutational analysis of the Bradyrhizobium japonicum symbiotic nitrogen fixation genes fixL and fixJ are reported here. The two genes were adjacent and probably formed an operon, fixLJ. The predicted FixL and FixJ proteins, members of the two-component sensor/regulator family, were homologous over almost their entire lengths to the corresponding Rhizobium meliloti proteins (approx. 50% identity). Downstream of the B. japonicum fixJ gene was found an open reading frame with 138 codons (ORF138) whose product shared 36% homology with the N-terminal part of FixJ. Deletion and insertion mutations within fixL and fixJ led to a loss of approximately 90% wildtype symbiotic nitrogen fixation (Fix) activity, whereas an ORF138 mutant was Fix⁺. In fixL, fixJ and ORF138 mutant backgrounds, the aerobic expression of the fixR-nifA operon was not affected. NifA itself did not regulate the expression of the fixJ gene. Thus, the B. japonicum FixL and FixJ proteins were neither involved in the regulation of aerobic nifA gene expression nor in the anaerobic NifA-dependent autoregulation of the fixRnifA operon; rather they appeared to control symbiotically important genes other than those whose expression was dependent on the NifA protein. The fixL and fixJ mutant strains were unable to grow anaerobically with nitrate as the terminal electron acceptor. Therefore, some of the FixJ-dependent genes in B. japonicum may be concerned with anaerobic respiration.     

Nucleotide sequence of the fixABC region of Azorhizobium caulinodans ORS571: similarity of the fixB product with eukaryotic flavoproteins, characterization of fixX, and identification of nifW.

Summary The nucleotide sequence of a 4.1 kb DNA fragment containing the fixABC region of Azorhizobium caulinodans was established. The three gene products were very similar to the corresponding polypeptides of Rhizobium meliloti. The C-terminal domains of both fixB products displayed a high degree of similarity with the -subunits of rat and human electron transfer flavoproteins, suggesting a role for the FixB protein in a redox reaction. Two open reading frames (ORF) were found downstream of fixC. The first ORF was identified as fixX on the basis of sequence homology with fixX from several Rhizobium and Bradyrhizobium strains. The second ORF potentially encoded a 69 amino acid product and was found to be homologous to a DNA region in the Rhodobacter capsulatus nif cluster I. Insertion mutagenesis of the A. caulinodans fixX gene conferred a Nif^– phenotype to bacteria grown in the free-living state and a Fix^– phenotype in symbiotic association with the host plant Sesbania rostrata. A crude extract from the fixX mutant had no nitrogenase activity. Furthermore, data presented in this paper also indicate that the previously identified nifO gene located upstream of fixA was probably a homologue of the nifW gene of Klebsiella pneumoniae and Azotobacter vinelandii.