Software tools for analyzing pairwise alignments of long sequences.

Pairwise comparison of long stretches of genomic DNA sequence can identify regions conserved across species, which often indicate functional significance. However, the novel insights frequently must be windowed from a flood of information; for instance, running an alignment program on two 50-kilobase sequences might yield over a hundred pages of alignments. Direct inspection of such a volume of printed output is infeasible, or at best highly undesirable, and computer tools are needed to summarize the information, to assist in its analysis, and to report the findings. This paper describes two such software tools. One tool prepares publication-quality pictorial representations of alignments, while another facilitates interactive browsing of pairwise alignment data. Their effectiveness is illustrated by comparing the beta-like globin gene clusters between humans and rabbits. A second example compares the chloroplast genomes of tobacco and liverwort.     

The nucleotide sequence of rabbit embryonic globin gene beta 3

The nucleotide sequence of a rabbit embryonic globin gene, beta 3, has been determined from 161 base pairs (bp) on the 5' side of the mRNA cap site to 209 base pairs beyond the 3' poly A addition site. The 5' and 3' ends of mRNA from both embryonic globin genes beta 3 and beta 4 have been determined by an S1 protection assay. Sequences that are highly conserved in the 5' flanking region of eukaryotic structural genes, AATAAAA and CCAAT, are located -25 to -31 nucleotides and -81 to -85 nucleotides, respectively, before the cap site. The CCAAT sequence is duplicated at -108 to -112 nucleotides, as it is in the human fetal gamma-globin genes. Small (124 bp) and large (817 bp) intervening sequences are located between codons 30 and 31 and between 104 and 105, respectively. The sequence AATAAA precedes the predominant poly(A) addition site by 19 nucleotides. Although rabbit globin gene beta 3 is transcribed and translated almost exclusively in embryonic erythrocytes, it shares striking homology with the human gamma-globin genes which are expressed in erythrocytes from fetal liver. The evolutionary conservation of rabbit beta 3 and human gamma correlates well with their similar chromosomal positions in the two genes families.     

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.     

Constrained sequence alignment

This paper presents a dynamic programming algorithm for aligning two sequeces when the alignment is constrained to lie between two arbitrary boundary lines in the dynamic programming matrix. For affine gap penalties, the algorithm requires onlyO(F) computation time andO(M+N) space, whereF is the area of the feasible region andM andN are the sequence lengths. The result extends to concave gap penalties, with somewhat increased time and space bounds. K.-M. C. and W. M. were supported in part by grant R01 LM05110 from the National Library of Medicine. R. C. H. was supported by PHS grant R01 DK27635.     

Localization of the alpha-like globin gene cluster to region q12 of rabbit chromosome 6 by in situ hybridization

The rabbit (Oryctolagus cuniculus) alpha-like globin gene cluster (HBAC) contains several block duplications of zeta-, alpha and theta-globin genes. Using in situ hybridizations to metaphase chromosome spreads, the gene cluster has been mapped to region q12 of chromosome 6. Given that human HBAC maps to the short arm of chromosome 16, the mapping of rabbit HBAC to 6q12 confirms the assignment of homology between OCU6q and HSA16p based on similarities of chromosomal banding patterns. In both species, HBAC is in a very G + C-rich region within the most distal band of the chromosome.     

Evidence for linkage of migraine in Rolandic epilepsy to known 1q23 FHM2 and novel 17q22 genetic loci

Migraine headaches are a common comorbidity in Rolandic epilepsy (RE) and familial aggregation of migraine in RE families suggests a genetic basis not mediated by seizures. We performed a genome‐wide linkage analysis of the migraine phenotype in 38 families with RE to localize potential genetic contribution, with a follow‐up in an additional 21 families at linked loci. We used two‐point and multipoint LOD (logarithm of the odds) score methods for linkage, maximized over genetic models. We found evidence of linkage to migraine at chromosome 17q12‐22 [multipoint HLOD (heterogeneity LOD) 4.40, recessive, 99% penetrance], replicated in the second dataset (HLOD 2.61), and suggestive evidence at 1q23.1‐23.2, centering over the FHM2 locus (two‐point LOD 3.00 and MP HLOD 2.52). Sanger sequencing in 14 migraine‐affected individuals found no coding mutations in the FHM2 gene ATP1A2. There was no evidence of pleiotropy for migraine and either reading or speech disorder, or the electroencephalographic endophenotype of RE when the affected definition was redefined as those with migraine or the comorbid phenotype, and pedigrees were reanalyzed for linkage. In summary, we report a novel migraine susceptibility locus at 17q12‐22, and a second locus that may contribute to migraine in the general population at 1q23.1‐23.2. Comorbid migraine in RE appears genetically influenced, but we did not obtain evidence that the identified susceptibility loci are consistent with pleiotropic effects on other comorbidities in RE. Loci identified here should be fine‐mapped in individuals from RE families with migraine, and prioritized for analysis in other types of epilepsy‐associated migraine.