Robust numerical solution for the two parameter solute solvent transport model

Prediction of solute and solvent transport in cells is central to developing and testing cryopreservation protocols. As we show here, however, the models used can be difficult to accurately numerically integrate in some key cases, and thus are a challenge to implement when determining the time dependent cell state during cryoprotectant equilibration and cooling. Exact solution techniques exist for overcoming this problem, but their implementation is also challenging: inversion of a nonlinear function is required that negates much of the utility of the approach. This communication describes a simple approach for more robust numerical integration that can be implemented using any numerical differential equation solver, and can facilitate arbitrarily accurate solutions to transport models without the complication of inversion formulae or complicated numerical integration schemes. Further, a simple relevant example of red blood cell equilibration with 40% glycerol is presented with comments on extending the approach to other settings.     

Fungizide: Risiken der resistenzentwicklung und suche nach neuen targets

Trotz intensiver Bemühungen im Bereich des Pflanzenschutzes sind weltweit erhebliche Verluste im Bereich pflanzlicher Erntegüter zu verzeichnen. Rund ein Drittel der Verluste werden mikrobiellen Schaderregern, also Pilzen, Bakterien und Viren, zugeschrieben. Besonders schwierig ist der Tatsache zu begegnen, dass Pilze gegenüber spezifisch wirkenden Fungiziden Insensitivitäten bzw. Resistenzen entwickeln. Aus diesem Grunde muss über geeignete Strategien beim Fungizideinsatz, beim ‘Disease management’ und bei der Suche nach neuen, hochwirksamen Fungiziden nachgedacht werden. Der Erfolg bei der Suche nach neuen Fungiziden wird stark davon abhängen, ob neue Zielmoleküle für potentielle Fungizide entdeckt werden können. Dabei können moderne molekulargenetische Techniken von großem Nutzen sein.     

Contribution of genetic and epigenetic mechanisms to Wnt pathway activity in prevalent skeletal disorders

We reported previously that the expression of Wnt-related genes is lower in osteoporotic hip fractures than in osteoarthritis. We aimed to confirm those results by analyzing β-catenin levels and explored potential genetic and epigenetic mechanisms involved.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Population-response model for vibrotactile spatial summation

A computational model based on previous physiological and psychophysical data is presented for the human Pacinian (P) psychophysical channel. The model can predict the probability of detection in simple psychophysical tasks, and hence psychometric functions and thresholds. The model simulates stimulating variable and fixed glabrous skin sites with different-sized contactors and includes spatial variation of monkey P-fiber sensitivities. Therefore, it is especially suitable for studying spatial summation, i.e. the improvement of threshold with increasing contactor area. Selective contributions of neural integration (n.i.) and probability summation (p.s.) are also incorporated into the model. Model predictions are compared to psychophysical results of Gescheider et al. (). The performance of the model regarding the effects of contactor size is very good. In addition to predicting approximately 3?dB improvement of thresholds when the contactor area is doubled, the model also reveals nonlinear contributions of p.s. and n.i. Furthermore, the model asserts that thresholds are largely governed by neural integration when small contactors are used. These and other findings discussed in the article show that the presented model is a helpful tool for formulating testable hypotheses. Although the model can also simulate some temporal summation effects, simulation results do not conform well to previous data on temporal response properties. Thus, the model needs to be refined in that respect.     

Gender identity and integration: second-generation Somali immigrants navigating gender in Canada

Many right-leaning politicians claim that normative Islamic perspectives on gender are at odds with the Western values and act as barriers to immigrant integration. Our interviews with 256 second-generation Somali-Canadians, however, suggest that gender-egalitarian identities are achieved – they are constructed and deployed by our participants to practice integration and express belonging in Canada. In this study, we move beyond analysis of attaining gender-egalitarian roles as a result of immigration and propose an understanding of gender as a form of Bourdieusian cultural capital that, depending on social values, functions as symbolic capital rendering individuals and groups as advantaged or disadvantaged. We, therefore, analyse modalities of “doing” gender as potential strategies of accumulating capital in furthering successful integration. Our study contributes to the emergent literature in migration studies that examines gender in relation to ethnic and national identities, and the extent to which it may impact integration experiences of second-generation Muslim immigrants.     

‘Have you got the Britísh?’: narratives of migration and settlement among Albanian-origin immigrants in London

Studies on migration and integration in Britain have noted the paucity of research on ‘new’ migrants, especially ‘illegal’ migrants and asylum seekers. This paper focuses on one understudied group – Albanian immigrants and their children – and looks at their migration and settlement, based on sixty interviews conducted in two phases either side of a 2003 mini-amnesty that gave many indefinite leave to remain. This regularization is the fulcrum around which our analytical narrative is built. Focusing on the interaction of migrants' agency with host-country structure, the paper shows that an unsettled asylum policy and delays in implementation have had deleterious effects on migrants' integration and sense of belonging, even after citizenship acquisition. As they search for a social and ethnic positioning within a multi-ethnic host society, the eventual realization of Albanians' migration project is accompanied by culture shock, intergenerational difference and ambivalence towards integration.     

Challenging the racialization of child sexual exploitation: Muslim men,racism and belonging in Rotherham

This paper presents findings from original research exploring the impact on Muslim men of a child sexual exploitation scandal that attracted significant attention to the northern English town where they live and contributed to a sustained detrimental effect on local community relations. It foregrounds men’s accounts to reveal their agency and resilience in responding to racism that they identified as resulting from the scandal. It reveals how their accounts disrupt dominant discourses foregrounding Muslim self-segregation and lack of integration, demonstrating positive attachments and claims to localized space, and commitment to belonging. In doing so, it shows how men’s responses to racism challenge racialized forms of knowledge about Muslims. The paper draws attention to the significance of localized forms of belonging in facilitating the inclusion of Muslim minorities. It also highlights the importance of centring Muslim men as historically speaking subjects in accounts of issues involving them.     

Assimilation without groups?

In “Origins and Destinations”, Luthra, Soehl and Waldinger aim at “extending the canon” in research on immigrant integration. They do so by studying group and individual level characteristics across a large number of origin groups, thereby replacing group labels with theoretically relevant variables at the group level. In this review, three challenges in this endeavour are discussed: First of all, the analyses do not allow to disentangle the impact of group and individual level characteristics for all variables alike. Secondly, a primary data collection more tailored to the specifics of their conceptual framework is needed. This would many conclusions about how contexts of emigration and immigration truly matter above and beyond individual characteristic on a more solid ground. And third, the authors’ aim to abandon the use of origin group categories in empirical research on immigrant integration may come at a price.