Induction of Krüppel‐like factor 2 reduces K/BxN serum‐induced arthritis

Krüppel‐like factor 2 (KLF2) critically regulates activation and function of monocyte, which plays important pathogenic role in progressive joint destruction in rheumatoid arthritis (RA). It is yet to be established the molecular basis of KLF2‐mediated regulation of monocytes in RA pathogenesis. Herein, we show that a class of compound, HDAC inhibitors (HDACi) induced KLF2 expression in monocytes both in vitro and in vivo. KLF2 level was also elevated in tissues, such as bone marrow, spleen and thymus in mice after infusion of HDACi. Importantly, HDACi significantly reduced osteoclastic differentiation of monocytes with the up‐regulation of KLF2 and concomitant down‐regulation of matrixmetalloproteinases both in the expression level as well as in the protein level. In addition, HDACi reduced K/BxN serum‐induced arthritic inflammation and joint destruction in mice in a dose‐dependent manner. Finally, co‐immunoprecipitation and overexpression studies confirmed that KLF2 directly interacts with HDAC4 molecule in cells. These findings provide mechanistic evidence of KLF2‐mediated regulation of K/BxN serum‐induced arthritic inflammation.     

The mechanism of phosphatidylcholine‐induced interference of PAP (248‐286) aggregation

Seminal amyloids are well known for their role in enhancing HIV infection. Among all the amyloidogenic peptides identified in human semen, PAP_248‐286 was found to be the most active and was termed as semen‐derived enhancer of viral infection (SEVI). Although amyloidogenic nature of the peptide is mainly linked with enhancement of the viral infection, the most active physiological conformation of the aggregated peptide remains inconclusive. Lipids are known to modulate aggregation pathway of a variety of proteins and peptides and constitute one of the most abundant biomolecules in human semen. PAP_248‐286 significantly differs from the other known amyloidogenic peptides, including Aβ and IAPP, in terms of critical concentration, surface charge, fibril morphology, and structural transition during aggregation. Hence, in the present study, we aimed to assess the effect of a lipid, 1,2‐dioleoyl‐sn‐glycero‐3‐phosphocholine (DOPC), on PAP_248‐286 aggregation and the consequent conformational outcomes. Our initial observation suggested that the presence of the lipid considerably influenced the aggregation of PAP_248‐286. Further, ZDOCK and MD simulation studies of peptide multimerization have suggested that the hydrophobic residues at C‐terminus are crucial for PAP_248‐286 aggregation and are anticipated to be major DOPC‐interacting partners. Therefore, we further assessed the aggregation behaviour of C‐terminal (PAP_273‐286) fragment of PAP_248‐286 and observed that DOPC possesses the ability to interfere with the aggregation behaviour of both the peptides used in the current study. Mechanistically, we propose that the presence of DOPC causes considerable inhibition of the peptide aggregation by interfering with the peptide's disordered state to β‐sheet transition.     

Mechanism of Acetic Acid Gustatory Repulsion in Drosophila

1. Download high-res image (206KB)
2. Download full-size image

     

Visceral leishmaniasis: what are the needs for diagnosis, treatment and control?

Visceral leishmaniasis (VL) is a systemic protozoan disease that is transmitted by phlebotomine sandflies. Poor and neglected populations in East Africa and the Indian sub-continent are particularly affected. Early and accurate diagnosis and treatment remain key components of VL control. In addition to improved diagnostic tests, accurate and simple tests are needed to identify treatment failures. Miltefosine, paromomycin and liposomal amphotericin B are gradually replacing pentavalent antimonials and conventional amphotericin B as the preferred treatments in some regions, but in other areas these drugs are still being evaluated in both mono- and combination therapies. New diagnostic tools and new treatment strategies will only have an impact if they are made widely available to patients.     

Insulin adsorption onto zinc oxide nanoparticle mediates conformational rearrangement into amyloid-prone structure with enhanced cytotoxic propensity

Background

Injection localized amyloidosis is one of the most prevalent disorders in type II diabetes mellitus (TIIDM) patients relying on insulin injections. Previous studies have reported that nanoparticles can play a role in the amyloidogenic process of proteins. Hence, the present study deals with the effect of zinc oxide nanoparticles (ZnONP) on the amyloidogenicity and cytotoxicity of insulin.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.