The Detection of Hamster Connexins: A Comparison of Expression Profiles with Wild-Type Mouse and the Cancer-Prone Min Mouse

The open reading frames of 17 connexins from Syrian hamster (using tissues) and 16 connexins from the Chinese hamster cell line V79, were fully (Cx30, Cx31, Cx37, Cx43 and Cx45) or partially sequenced. We have also detected, and partially sequenced, seven rat connexins that previously were unavailable. The expression of connexin genes was examined in some hamster organs and cultured hamster cells, and compared with wild-type mouse and the cancer-prone Min mouse. Although the expression patterns were similar for most organs and connexins in hamster and mouse, there were also some prominent differences (Cx29 and 30.3 in testis; Cx31.1 and 32 in eye; Cx46 in brain, kidney and testis; Cx47 in kidney). This suggests that some connexins have species-specific expression profiles. In contrast, there were minimal differences in expression profiles between wild type and Min mice. Species-specific expression profiles should be considered in attempts to make animal models of human connexin-associated diseases.     

Transmission of a New Mycoplasma-Like Organism (MLO) from Cuscuta odorata (Ruiz et Pav.) to Herbaceous Plants and Attempts to its Elimination in the Vector

A new MLO-type, originating from a holoparasite plant Cuscuta odorata (Ruiz et Pav.) causing stunting and reduction of flower- and leaf size on Catharanthus roseus (L.) G. Don. (HEINTZ 1986) was transmitted to Apium graveolens L., Plantago major L., Bellis perennis L. and Cirsium japonicum hybrid. The observed symptoms on the test plants probably caused by the MLO have not yet been described in the literature. The symptomatology on these herbaceous plants gives further data in order to classify the MLO as a new one which is named Guscuta latent MLO (Cl-MLO). Attempts to transmit the pathogens by the leafboppers Euscelidius variegates (Kirschbaum) and Euscelis lineolatus (Brullé) failed. It also was impossible to elimmate the MLO completely from Cuscuta odorata by heat treatment and antibiotic application. However, we succeeded in eliminating the pathogens from Catharanthus roseus by heat treatment.     

La question de la sensibilité des Abeilles A l'ultra-violet

Zusammenfassung Es wurde die Reaktion von Bienen auf monochromatische Lichter und variabler Intensität im Spektrum von 300 bis 665 m untersucht. Das Spaltbild eines Spektrographen wurde auf die Wand einer Versuchskammer vergrössert abgebildet. Als Test der Reaktion wurde die Zahl der Bienen genommen die während einer vorgegebenen Zeit auf das Spaltbild zugehen und ihm entlanglaufen.Dabei ergaben sich folgende Resultate: 1) Eine lineare Abhängigkeit zwischen der Reaktionszahl und dem Logarithmus der verwendeten Spektralenergie für alle verwendeten monochromatischen Lichter. 2) Eine spektrale Empfindlichkeitskurve mit zwei Maxima bei 550 und bei 365 m. Das Letztere ist etwa doppelt so intensif wie das im Sichtbaren.Die gefundenen Resultate bestätigen z. Teil die Resultate Bertholf's und ergänzen sie. Es konnte gezeigt werden, warum bei Sander das Max. bei 365 m nicht auftritt.Weiterhin konnte nachgewiesen werden, dassApis mellifica keinerlei Lichthautsinn besitzt.     

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.     

Effects of Oxygen and Temperature on the Activity and. Survival of Nothanguina phyllobia

The effects of oxygen and temperature on the activity and survival of infective forth-stage juveniles of Nothanguina phyllobia Thorne were examined in aqueous suspension. Rate of movement was not affected by a wide range of O₂ concentration (0.8-8.6 ppm). Activity decreased below 0.8 ppm 0 2, and at 0.15 ppm O₂ nematodes became motionless. Activity increased as a linear function of temperature up to a thermal optimum of 24 C; beyond 24 C activity decreased. Survival was greatly prolonged at low temperature. At 23 C, 50% mortality occurred within 7 d, whereas at 4 C, 70% survived after 98 d.     

Sensitivity of cultured rat hepatocytes to aflatoxin B1 and benzo(a)pyrene.

We have tested the sensitivity of a cloned rat hepatocyte line, RL-PR-C, to aflatoxin B1 and benzo(a)pyrene as a function of population-doubling level. The cells were much more sensitive to the cytotoxic action of these agents subsequent to 230 population doublings. This sensitivity corresponded to the enhanced inducibility of aryl hydrocarbon hydroxylase activity by 3-methylcholanthrene.