Indels within promoter and intron 1 of bovine prion protein gene modulate the gene expression levels in the medulla oblongata of two Japanese cattle breeds

Genetic differences which exist in the prion protein gene (PRNP) have been reported to influence susceptibility of humans, sheep and goats to prion diseases. In cattle, however, none of the known coding polymorphisms has a direct effect on bovine spongiform encephalopathy (BSE). It has been reported that 23‐bp insertion/deletion (indel) polymorphisms within the promoter region have a tentative association to BSE susceptibility in German cattle, and a lower number of 24‐bp repeat units in the open reading frame (ORF) was reported to reduce BSE susceptibility in transgenic mice. In this study, because of the hypothesis that bovine PRNP promoter polymorphisms cause changes in PRNP expression, we genotyped PRNP polymorphisms in the promoter and intron 1 using 218 genomic DNA samples from two Japanese cattle breeds. We also analysed the expression levels of prion in 40 animals by quantification of real‐time PCR using mRNAs extracted from the medulla oblongata to study the relationship between PRNP genotypes and PRNP expression. We found a significant correlation between promoter indel polymorphisms and PRNP‐mRNA expression (P_0.0413) and therefore hypothesize that differences in polymorphisms could be one of the causes of differences in PRNP expression levels. We also report a novel difference in PRNP expression (P < 0.0001) between Japanese Black and Japanese Brown cattle breeds. There was no significant difference based on age and sex of the animals.     

Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene

The detection method based on the mathematical expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3′ untranslated region (3′ UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.     

Polymorphism of the prion protein gene (<Emphasis Type="Italic">PRNP</Emphasis>) in two Chinese indigenous cattle breeds

Prion protein (PRNP) gene has been located at position q17 of chromosome 13 in cattle. The polymorphisms of PRNP gene might be associated with BSE susceptibility. In the present work, we investigated the polymorphisms of PRNP gene, including SNP in exon 3, 23-bp indel in promoter region, 12-bp indel in intron 1 in 2 Chinese indigenous cattle breeds of northeast China. Eighty-six animals from Yanbian (34) and Chinese Red Steppes (52) were genotyped at PRNP locus by analyzing genomic DNA. A total of 4 single nucleotide polymorphism (SNP) sites were revealed in the PRNP gene exon 3 of the 2 cattle breeds investigated. Three of these SNPs were non-synonymous mutations that resulted in the amino acid exchanges (K119N, S154N, and M177V), and one is silent nucleotide substitutions (A234G). The two amino acid mutations of S154N and M177V were detected only in Yanbian with a very low frequency (0.0147), and they appears to be absent in Chinese Red Steppes. The average gene heterozygosity (H _e), effective allele numbers (N _e), Shannon’s information index (I) and polymorphism information content (PIC) were 0.3088, 1.5013, 0.3814 and 0.2000 in Yanbian, respectively, being relatively higher than that of Chinese Red Steppes (0.2885, 1.4985, 0.3462 and 0.1873, respectively). In 23-bp indel and 12-bp indel loci, three different genotypes were identified in both Yanbian and Chinese Red Steppes breeds. Based 23- and 12-bp indels, four haplotypes was constructed in the 2 Chinese cattle breeds, of which the 23-bp (−)/12-bp (−) was main haplotypes accounting for more than 50% of the total in both Yanbian and Chinese Red Steppes breeds. These results might be useful in understanding the genetic characteristics of PRNP gene in Chinese indigenous cattle breeds.     

Characterization of <Emphasis Type="Italic">PRNP</Emphasis> and <Emphasis Type="Italic">SPRN</Emphasis> coding regions from atypical scrapie cases diagnosed in Poland

Scrapie, a fatal transmissible spongiform encephalopathy (TSE) occurs in two phenotypes: classical and atypical. Many authors point out that the polymorphism of three codons (136, 154, 171) of the PRNP (PrP gene) is associated with a sheep susceptibility to classical scrapie. Until now, only one PRNP gene variant coding phenylalanine at codon 141 has been found to be associated with atypical scrapie. Another recently identified and interesting candidate gene for scrapie susceptibility in sheep is an SPRN gene coding for Shadoo protein (Sho). Sho is a highly interspecies conserved protein and an insertion/deletion (indel) found in a sheep Sho gene was associated with classical scrapie occurrence. Here we determined the polymorphism of PRNP and SPRN genes in nine atypical scrapie cases (six in native born sheep and three in imported sheep) and compared these results with a control group of healthy animals comprising six corresponding Polish sheep breeds. In atypical scrapie cases five PRNP diplotypes were identified: A₁₃₆R₁₅₄Q₁₇₁/ARQ, AHQ/ARQ, ARR/ARQ, ARR/AHQ and AHQ/AHQ. The ARR/AHQ diplotype was found only in imported sheep. A previously unobserved SNP in PRNP (E224K) was also found in both atypical scrapie and in a few control animals. In the ORF of the SPRN gene, six SNPs and one indel were identified. None of these variations was exclusive for scrapie animals and they were probably, naturally occurring polymorphisms. Special attention was given to the 6-bp indel SPRN polymorphism which was previously associated with classical scrapie occurrence.     

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method

Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.     

Deletion / insertion polymorphisms of the prion protein gene (<Emphasis Type="BoldItalic">PRNP</Emphasis>) in gayal (<Emphasis Type="BoldItalic">Bos frontalis</Emphasis>)

Resistance to fatal disease bovine spongiform encephalopathy (BSE), due to misfolded prion protein in cattle, is associated with a 23-bp indel polymorphism in the putative promoter and a 12-bp indel in intron 1 of the PRNP gene. Gayal (Bos frontalis) is an important semiwild bovid species and of great conservation concern, but till today these indel polymorphisms have not been evaluated in gayals. Therefore, we collected 225 samples of gayals and evaluated the genetic indel polymorphism in the two regions of this PRNP gene. The results revealed high allelic frequencies of insertions at these indel sites: 0.909 and 0.667 for, respectively, the 23 bp and 12 bp indels, both also with significant genotype frequencies (\(\chi ^{2}\): 9.81; 23 bp and \(\chi ^{2}\): 43.56; 12 bp). At the same time, the haplotype data showed indel polymorphisms with extremely low deletion (0.01) in both regions of the PRNP gene. We compared these data with those reported for healthy and BSE-affected cattle (Bos taurus) breeds from two European countries, Germany and Switzerland, and significant difference (\(P\,{<}\,0.001\)) was observed between BSE-affected as well as the healthy cattle. Further, our data were also extensively compared with previous reports on BSE and highly significant (\(P\,{<}\,0.001\)) outcomes were observed. This result suggested negligible genetic susceptibility to BSE in gayals. To the best of our knowledge, this study is the first comprehensive deciphering information about the PRNP indel polymorphisms of 23 bp and 12 bp in gayals, a semiwild species of China.     

Nucleotide variants in prion-related protein (testis-specific) gene (PRNT) and effects on Chinese and Mongolian sheep phenotypes

ABSTRACT

Studies of the ovine prion-related protein (testis-specific) gene (PRNT), including studies of genetic diversity, have highlighted its potential relationship to scrapie infection and economically important ovine traits. PRNT was previously reported to be highly polymorphic in Portuguese sheep. To characterize genetic polymorphisms in this gene in Asian sheep, a direct sequencing method was used to detect polymorphic loci in PRNT in 285 individual sheep from four Chinese and one Mongolian breeds. Seven SNP variants in PRNT were identified, including three novel variants (g.93G>A, g.162G>T, and g.190A>G) and four previously reported variants (g.17 C>T, g.112G>C, g.129C>T, and g.144A>G). In the five breeds that we analyzed, the mutation frequencies of g.190A>G in Lanzhou Fat-tail sheep (LFTS) and g.129C>T in the other four varieties were high (F>0.5). Moreover, thirteen different haplotypes that had a comparable distribution in the tested breeds were also identified; ‘C-G-G-C-A-G-A’ occurred at the highest frequency in the five sheep breeds. Additionally, we previously explored the significance of relationships between polymorphisms in PRNP or PRND and ovine growth performance. Here, we also performed correlation analysis in all tested loci. These loci polymorphisms were significantly associated with ten different growth traits (P<0.05), except for g.93G>A. Meanwhile, in contrast to a previous study, there was no significant association between the seven SNP loci analyzed and our previously reported sheep PRND or PRNP insertion/deletion mutations. Our findings may provide new insights into polymorphic variation in ovine PRNT, which may contribute to genetic improvements in economic traits that are important for sheep breeding.     

Polymorphism of the prion protein gene (<Emphasis Type="Italic">PRNP</Emphasis>) in Polish cattle affected by classical bovine spongiform encephalopathy

Recent attempts to discover genetic factors affecting cattle resistance/susceptibility to bovine spongiform encephalopathy (BSE) have led to the identification of two insertion/deletion (indel) polymorphisms, located within the promoter and intron 1 of the prion protein gene PRNP, showing a significant association with the occurrence of classical form of the disease. Because the effect of the polymorphisms was studied only in few populations, in this study we investigated whether previously described association of PRNP indel polymorphisms with BSE susceptibility in cattle is also present in Polish cattle population. We found a significant relation between the investigated PRNP indel polymorphisms (23 and 12 bp indels), and susceptibility of Polish Holstein-Friesian cattle to classical BSE (P < 0.05). The deletion variants of both polymorphisms were related to increased susceptibility, whereas insertion variants were protective against BSE.     

Identification of a novel 43-bp insertion in the heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene and its associations with growth and carcass traits in chickens

Previous studies have revealed a significant association between SNPs found within the heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene and obesity. This study identified a novel 43-bp indel polymorphism in intron 1 of HS6ST3 in 1963 chickens from nine different breeds, and three genotypes, designated II, ID and DD, were observed. The frequency of the ‘I’ (0.62–0.87) allele was higher than that of the ‘D’ (0.13–0.38) allele. A total of 777 individuals of the Gushi-Anka F₂ resource population were used for the analysis of associations according to growth traits, carcass traits, serum variables and meat quality traits. The results showed that the 43-bp indel polymorphism was significantly associated with the body weight at 4 and 6 weeks of age, chest depth at 4 and 12 weeks of age and shank girth at 12 weeks of age (P?<?0.05). In terms of the carcass traits, the indel polymorphism was significantly associated with breast muscle weight, heart weight and leg weight (P?<?0.05). These findings suggested that this indel polymorphism has the potential to become a new target for the marker-assisted selection of chicken growth and carcass traits.     

Prion‐like Doppel gene polymorphisms and scrapie susceptibility in portuguese sheep breeds

The establishment of an association between prion protein gene (PRNP) polymorphisms and scrapie susceptibility in sheep has enabled the development of breeding programmes to increase scrapie resistance in the European Union. Intense selection for PRNP genotype may lead to correlated selection for genes linked to PRNP. We intended to investigate if any association exists between genetic variation in prion‐like protein Doppel gene (PRND) and scrapie susceptibility, determined through PRNP genotyping. Sampling included 460 sheep from eight Portuguese breeds and the PRND gene coding region was analysed by multiple restriction fragment‐single strand conformation polymorphism (MRF‐SSCP), whereas PRNP genotyping was carried out by primer extension. A synonymous substitution (c.78G>A) was detected in codon 26 of the PRND gene, in all breeds except Churra Mondegueira. Linkage disequilibrium was found between the PRND and PRNP loci (P = 0.000). Specifically, PRND was monomorphic in the 45 animals with the more resistant ARR/ARR PRNP genotype (P = 0.003), whereas a higher frequency of PRND heterozygotes (GA) was associated with ARQ/AHQ (P = 0.029). These results constitute preliminary evidence of an association between a polymorphism in the PRND gene and scrapie susceptibility, and indicate that the possibility of undesirable consequences from widespread selection for PRNP genotype on genetic diversity and reproduction traits needs to be further investigated.     

Linkage disequilibrium across six prion gene regions spanning 20 kbp in U.S. sheep

Single nucleotide polymorphisms (SNPs) and haplotype alleles within the prion gene (PRNP) coding sequence of domestic sheep (Ovis aries) are associated with genetic predisposition to scrapie, a transmissible spongiform encephalopathy disease of sheep. This report describes regions of linkage disequilibrium (LD) throughout the PRNP gene region in U.S. sheep and provides a genetic framework for identifying additional PRNP determinants associated with scrapie resistance. Four sequence tagged sites (i.e., STS or amplicons) totaling 3869 bp and spanning 20 kbp of genomic PRNP sequence were sequenced in a diverse panel of 90 sires representing ten popular U.S. breeds of sheep. Analysis of these sequences identified 36 previously unreported polymorphisms. In combination with two previously characterized STS, 62 polymorphisms were analyzed in a 20-kbp PRNP region in this panel of U.S. sheep. Two regions of strong LD and ten common haplotypes were identified. The haplotype encoding amino acid residues A, R, and Q at codons 136, 154, and 171, respectively, was observed on nine larger haplotypes spanning PRNP from the promoter region to the 3′ untranslated region. The haplotype encoding VRQ was observed on two larger haplotypes, whereas ARR, ARH, and AHQ were each present on a single haplotype. The existence of multiple haplotypes encoding ARQ raises the question of whether sheep bearing these different haplotypes are equally susceptible to scrapie. The haplotype structure within the 20-kbp region of PRNP identified in this study is important for higher-resolution analysis of genetics contributions to scrapie susceptibility. Nucleotide sequence data reported are available in the DDBJ/EMBL/GenBank databases under the accession number DQ077504.     

Novel polymorphisms in ovine prion protein gene

The aim of this study was to identify the PRNP polymorphisms outside the standard codons 136, 154 and 171 in 1110 sheep with no clinical sign of scrapie from all 18 Turkish native sheep breeds and compare our results with published data on ovine PRNP polymorphism from other regions of the world. Among the 22 amino acid polymorphisms and three silent mutations, 10 were novel for ovine PRNP: p.Gly94Gly, p.Leu128Ile, p.Met132Leu, p.Ser135Arg, p.Met137Val, p.Asn146Lys, p.Arg159Arg, p.Tyr160Asn, p.Gln163His and p.Thr193Ser. These data reveal that sheep breeds close to the historic center of small ruminant domestication have remained highly diverse in the prion gene locus, with distinctive genetic similarities to both Asian and European sheep breeds.     

A major genetic component of BSE susceptibility

Background  

Coding variants of the prion protein gene (PRNP) have been shown to be major determinants for the susceptibility to transmitted prion diseases in humans, mice and sheep. However, to date, the effects of polymorphisms in the coding and regulatory regions of bovine PRNP on bovine spongiform encephalopathy (BSE) susceptibility have been considered marginal or non-existent. Here we analysed two insertion/deletion (indel) polymorphisms in the regulatory region of bovine PRNP in BSE affected animals and controls of four independent cattle populations from UK and Germany.     

Analysis of genetic variability at codon 42 within caprine <Emphasis Type="Italic">prion protein</Emphasis> gene in relation to production traits in Chinese domestic breeds

In this study, genetic variability at codon 42 within prion protein (PRNP) gene and its associations with production traits were investigated in 2002 goats from four Chinese domestic breeds. The frequencies of allele “A” ranged from 0.353 to 0.562 in analyzed goat breeds with Hardy–Weinberg equilibrium (P > 0.05) except Xinong Sannen (XNSN) dairy breed. The establishment of relationships between different genotypes and growth traits was performed in Inner Mongolia white Cashmere (IMWC) breed and revealed an association of the polymorphism with body weight at 7-year-old goats (P = 0.033). The individuals with genotype GG showed heavier body weight than those with genotype AA. Moreover, association analysis detected two significant associations between different genotypes and cashmere yield and fiber length in IMWC breed (P = 0.009, P = 0.048, respectively). In addition, three significant associations of different genotypes with density of milk (a.m. and p.m.), solids-not-fat of milk (P = 0.013, P = 0.009 and P = 0.002), respectively, were found in XNSN breed. Genotype GG had better milk quality than others. These findings suggested that the polymorphism of codon 42 within PRNP was a useful DNA marker for eliminating or selecting excellent individuals in relation to production traits in marker-assist selection breeding of goat.     

A large indel mutation of the bovine ADD1/SREBP1c gene and its effects on growth traits in some native cattle breeds from China

Adipocyte determination and differentiation-dependent factor 1/sterol regulatory element-binding protein-1c (ADD1/SREBP1c) is a major determinant of tissue differential lipogenic capacity in mammalian and avian species. The objectives of the present study were to focus on insertion-deletion polymorphism (indel) in the bovine ADD1/SREBP1c gene, and analyzing its effect on growth traits in a sample of 1035 cattle belonging to four Chinese cattle breeds. PCR-SSCP, DNA sequencing and agarose electrophoresis methods were used. The 778 bp PCR products of ADD1/SREBP1c gene exhibited three genotypes and two alleles were revealed: W and D. Frequencies of the W allele varied from 0.8651 to 1.000. The associations of the 84 bp indel mutation of ADD1/SREBP1c gene with growth traits of 265 Nanyang cows were analyzed. The animals with genotype WD had significantly higher birth weight, body weight, average daily gain than those with genotype WW at birth, 6-, 12-, 18-, and 24-month old (P < 0.05 or P < 0.01). These results suggest that the indel mutation of bovine ADD1/SREBP1c gene may influence the growth traits in cattle.     

A complete sequence of the pGA1611 binary vector

We report the nucleotide sequence of the binary vector pGA1611, which is used for the transformation of foreign DNA into rice. This vector is 13,476 bp long. The 5577- bp T- DNA region consists of a 1987- bp ubiquitine promoter region, 45 bp for the multiple cloning site, a 253- bpnos terminator region, and the 2045- bpCaMV35S- hph- T7 chimaeric gene. The vector backbone (7004 bp) carriesoriT,traJ,trfA,tetA,tetR, andoriV. An 892- bp RB region and the 489- bp LB region are also present The T- DNA possesses 15 unique sites, six of which are at the multiple cloning site. This information will be valuable for cloning foreign DNA and modifying the vector.     

Deletion/insertion polymorphism of the prion protein gene (<Emphasis Type="Italic">PRNP</Emphasis>) in Polish Red cattle,Polish White-backed cattle and European bison (<Emphasis Type="Italic">Bison bonasus</Emphasis> L., 1758)

The aim of the present study was to identify deletion/insertion polymorphism of the bovine prion protein (PRNP) gene within the promoter sequence (23 bp indel), intron 1 (12 bp indel) and the 3′ end untranslated region (14 bp indel). The experiment was performed on three groups of animals protected under a genetic resources conservation program: 139 Polish Red (PR) cows, 79 Polish White-backed cows and 50 European bison (Bison bonasus L., 1758). White-backed cattle were characterized by a higher frequency of ins/del heterozygotes and a relatively lower frequency of ins/ins homozygotes within the promoter sequence region (23 bp indel), compared to Polish Red cattle. At the polymorphic locus of intron 1 (12 bp indel) the genetic structure of both cattle populations was similar. Monomorphism, expressed by the occurrence of one genotype variant in each of the analyzed sequence regions, was observed in European bison. Five haplotypes were found in Polish White-backed cows, four haplotypes in Polish Red cows and only one in analyzed group of bison. Differences between the observed and expected number of PRNP haplotypes were recorded in Polish Red cattle. The article is published in the original.     

A Missense Mutation in the Rabbit Melanocortin 4 Receptor (MC4R) Gene is Associated with Finisching Weight in a Meat Rabbit Line

In this study we resequenced 1729 bp of the rabbit melanocortin 4 receptor (MC4 R) gene in 31 rabbits from different breeds/lines and identified ten polymorphisms: one was an indel and 9 were single nucleotide polymorphisms (SNPs). The indel and 5 SNPs were in the 5′-flanking region, 3 were synonymous SNPs and one was a missense mutation (c.101G>A; p.G34D), located in a conserved position of the extracellular tail of the MC4 R protein. The missense mutation was analyzed in a panel of 74 rabbits of different breeds and in 516 performance tested rabbits of a commercial paternal line under selection for growth efficiency. Association analysis indicated that rabbits with the less frequent genotype in this population (DD) had a lighter weight at 70 postnatal days than animals with genotype GD (P < 0.10) and animals with genotype GG (P < 0.05). This is the third study on candidate genes, after those on GH1 and IGF2 that reported a marker associated with finishing weight. Therefore, it seems that a candidate gene approach in rabbit based on previous information accumulated in other livestock species could be useful to identify genes explaining a fraction of variability of performance traits with potential application on rabbit breeding and selection.