Genetic variation occurring on the genome of an in vitro insertion mutant of poliovirus type 1.

An insertion sequence of 72 nucleotides prepared from a polylinker sequence of plasmid pUC18 was introduced at nucleotide position 702 of the 5' noncoding sequence (742 nucleotides long) of the genome of the Sabin strain of poliovirus type 1 by using an infectious cDNA clone of the virus strain. The insertion mutant thus obtained showed a small-plaque phenotype compared with that of the parent virus. Apparent revertants (large-plaque variants) were easily generated from the insertion mutant. Nucleotide sequence analysis was performed on the revertant genomes to determine the mutation(s) by which the plaque size of the parent virus was regained. Some large-plaque variants lacked genomic sequences including all or a part of the insertion sequence. A computer-aided search for secondary structures with respect to the deletion sites detected possible supporting sequences which provided fairly stable secondary structures at the deletion sites. This result was consistent with our supporting sequence-loop model which had been proposed as a new copy-choice model for the generation of genetic rearrangements occurring on single-stranded RNA genomes (S. Kuge, I. Saito, and A. Nomoto, J. Mol. Biol. 192:473-487, 1986). The other large-plaque variants had point mutations at any one of three positions of an AUG existing in the insertion sequence. A small-plaque phenotype was observed when an AUG codon was inserted in frame or out of frame with regard to the initiation site of viral polyprotein synthesis. Our data strongly suggest that an AUG sequence in this genome region is deleterious for efficient poliovirus replication.     

Strong inclination toward transition mutation in nucleotide substitutions by poliovirus replicase

A viable insertion mutant of the Sabin strain of type 1 poliovirus was constructed. The mutant carried an insertion sequence of 72 nucleotides at nucleotide position 702 in the 5' non-coding region (742 nucleotides long) of the genome of the Sabin strain. This mutant showed a small-plaque phenotype, as compared with the parental virus. Indeed, the final yield of the mutant in a single cycle of infection was tenfold fewer than that of the parental virus. Many large-plaque variants that are easily generated from the insertion mutant appeared to regain efficient viral replication and have single nucleotide changes. All nucleotide changes observed were limited to within three nucleotides of an AUG sequence in the insertion sequence. The result indicates strongly that the AUG sequence itself in this genome region functions in reducing the plaque size of the parental Sabin type 1 virus. The insertion mutant with a small-plaque phenotype may be the first in vitro mutant of poliovirus whose viability is lowered only by a primary sequence inserted into the 5' non-coding region of the genome. Base substitutions to alter the AUG sequence should largely be the result of errors of the virus-specific replicase, since variants with base substitutions must be subject to only minimum selection pressure. Accordingly, nucleotide sequence analysis of the genome region containing the AUG sequence was performed on a number of genomes of large-plaque variants to investigate types of nucleotide substitutions caused by characteristic errors in RNA replication. Only one transversion mutation was detected in the genomes of 44 independently isolated large-plaque variants with single base changes in the AUG sequence. This result suggests strongly that transition mutations occur predominantly as nucleotide substitutions caused by characteristic errors of poliovirus replicase.     

Construction of less neurovirulent polioviruses by introducing deletions into the 5' noncoding sequence of the genome.

Viral attenuation may be due to lowered efficiency of certain steps essential for viral multiplication. For the construction of less neurovirulent strains of poliovirus in vitro, we introduced deletions into the 5' noncoding sequence (742 nucleotides long) of the genomes of the Mahoney and Sabin 1 strains of poliovirus type 1 by using infectious cDNA clones of the virus strains. Plaque sizes shown by deletion mutants were used as a marker for rate of viral proliferation. Deletion mutants of both the strains thus constructed lacked a genome region of nucleotide positions 564 to 726. The sizes of plaques displayed by these deletion mutants were smaller than those by the respective parental viruses, although a phenotype referring to reproductive capacity at different temperatures (rct) of viruses was not affected by introduction of the deletion. Monkey neurovirulence tests were performed on the deletion mutants. The results clearly indicated that the deletion mutants had much less neurovirulence than with the corresponding parent viruses. Production of infectious particles and virus-specific protein synthesis in cells infected with the deletion mutants started later than in those infected with the parental viruses. The rate at which cytopathic effect progressed was also slower in cells infected with the mutants. Phenotypic stability of the deletion mutant for small-plaque phenotype and temperature sensitivity was investigated after passaging the mutant at an elevated temperature of 37.5 degrees C. Our data strongly suggested that the less neurovirulent phenotype introduced by the deletion is very stable during passaging of the virus.     

Replicase gene of coxsackievirus B3.

A cDNA copy covering two-thirds of the coxsackievirus B3 genome was cloned in the PstI site of the pBR322 vector. A nucleotide sequence containing the gene for the viral replicase and the 3' noncoding region of the coxsackievirus B3 genome was determined. The predicted amino acid sequence of the coxsackievirus B3 replicase was shown to be remarkably similar to that of the poliovirus 1 replicase. The 3' noncoding region, in contrast, was only weakly homologous to the poliovirus 1 sequence but showed a close relationship to the sequence of swine vesicular disease virus, a variant of coxsackievirus B5. A 13-nucleotide-long segment located near the polyadenylic acid junction is conserved in several members of the enterovirus group and may thus serve an important function during replication of viral RNA.     

Deletion mapping of Sindbis virus DI RNAs derived from cDNAs defines the sequences essential for replication and packaging

Defective-interfering (DI) genomes of a virus contain sequence information essential for their replication and packaging. They need not contain any coding information and therefore are a valuable tool for identifying cis-acting, regulatory sequences in a viral genome. To identify these sequences in a DI genome of Sindbis virus, we cloned a cDNA copy of a complete DI genome directly downstream of the promoter for the SP6 bacteriophage DNA dependent RNA polymerase. The cDNA was transcribed into RNA, which was transfected into chicken embryo fibroblasts in the presence of helper Sindbis virus. After one to two passages the DI RNA became the major viral RNA species in infected cells. Data from a series of deletions covering the entire DI genome show that only sequences in the 162 nucleotide region at the 5' terminus and in the 19 nucleotide region at the 3' terminus are specifically required for replication and packaging of these genomes.     

Cell-dependent role for the poliovirus 3' noncoding region in positive-strand RNA synthesis

We previously reported the isolation of a mutant poliovirus lacking the entire genomic RNA 3' noncoding region. Infection of HeLa cell monolayers with this deletion mutant revealed only a minor defect in the levels of viral RNA replication. To further analyze the consequences of the genomic 3' noncoding region deletion, we examined viral RNA replication in a neuroblastoma cell line, SK-N-SH cells. The minor genomic RNA replication defect in HeLa cells was significantly exacerbated in the SK-N-SH cells, resulting in a decreased capacity for mutant virus growth. Analysis of the nature of the RNA replication deficiency revealed that deleting the poliovirus genomic 3' noncoding region resulted in a positive-strand RNA synthesis defect. The RNA replication deficiency in SK-N-SH cells was not due to a major defect in viral translation or viral protein processing. Neurovirulence of the mutant virus was determined in a transgenic mouse line expressing the human poliovirus receptor. Greater than 1,000 times more mutant virus was required to paralyze 50% of inoculated mice, compared to that with wild-type virus. These data suggest that, together with a cellular factor(s) that is limiting in neuronal cells, the poliovirus 3' noncoding region is involved in positive-strand synthesis during genome replication.     

Genetic variation of the poliovirus genome with two VPg coding units.

Amongst the picornaviruses, poliovirus encodes a single copy of the genome-linked protein, VPg wheras foot-and-mouth disease virus uniquely encodes three copies of VPg. We have previously shown that a genetically engineered poliovirus genome containing two tandemly arranged VPgs is quasi-infectious (qi) that, upon genome replication, inadvertently deleted one complete VPg sequence. Using two genetically marked viral genomes with two VPg sequences, we now provide evidence that this deletion occurs via homologous recombination. The mechanism was abrogated when the second VPg was engineered such that its nucleotide sequence differed from that of the first VPg sequence by 36%. Such genomes also expressed a qi phenotype, but progeny viruses resulted from (i) random deletions yielding single VPg coding sequences of varying length lacking the Q*G cleavage site between the VPgs and (ii) mutations in the AKVQ*G cleavage sites between the VPgs at either the P4, P1 or P1' position. These variants present a unique genetic system defining the cleavage signals recognized in 3Cpro-catalyzed proteolysis. We propose a recognition event in the cis cleavages of the polyprotein P2-P3 region, and we present a hypothesis why the poliovirus genome does not tolerate two tandemly arranged VPg sequences.     

Sequences within the poliovirus internal ribosome entry segment control viral RNA synthesis.

The 5' untranslated region of poliovirus RNA has been reported to possess two functional elements: (i) the 5' proximal 88 nucleotides form a cloverleaf structure implicated in positive-strand RNA synthesis during viral replication, and (ii) nucleotides 134 to at least 556 function as a highly structured internal ribosome entry segment (IRES) during cap-independent, internal initiation of translation. We show here that the IRES itself is bifunctional and contains sequences necessary for viral RNA synthesis per se. For this purpose, we used a dicistronic poliovirus RNA in which the translation of the viral non-structural (replication) proteins is uncoupled from the poliovirus IRES. In this system, RNA synthesis is readily detectable in transfected cells, even when the poliovirus IRES is inactivated by point mutation. However, deletion of the major part of the poliovirus IRES renders viral-specific RNA synthesis undetectable. Using the same system, we show that a three nucleotide deletion at position 500 in the 5' untranslated region drastically affects both translation efficiency and RNA synthesis. Furthermore, disruption of the secondary structure of the IRES around nucleotide 343 has minimal effects on IRES function, but dramatically reduces viral RNA replication. Taken together, these results provide direct evidence that sequences essential for viral RNA synthesis are located in the 3' region of the poliovirus IRES.     

In vitro construction of poliovirus defective interfering particles.

To construct poliovirus defective interfering (DI) particles in vitro, we synthesized an RNA from a cloned poliovirus cDNA, pSM1(T7)1, which carried a deletion in the genome region corresponding to nucleotide positions 1663 to 2478 encoding viral capsid proteins, by using bacteriophage T7 RNA polymerase. The RNA was designed to retain the correct reading frame in nucleotide sequence downstream of the deletion. HeLa S3 monolayer cells were transfected with the deletion RNA and then superinfected with standard virus as a helper. The DI RNA was observed in the infected cells after three passages at high multiplicity of infection. The sequence analysis of RNA extracted from the purified DI particle clearly showed that this DI RNA had the same deletion in size and location as that in the RNA used for the transfection. Thus, we succeeded in construction of a poliovirus DI particle in vitro. To gain insight into the mechanism for DI generation, we constructed poliovirus cDNAs pSM1(T7)1a and pSM1(T7)1b that, in addition to the same deletion as that in pSM1(T7)1, had insertion sequences of 4 bases and 12 bases, respectively, at the corresponding nucleotide position, 2978. The RNA transcribed from pSM1(T7)1a was not a template for synthesis of poliovirus nonstructural proteins and therefore was inactive as an RNA replicon. On the other hand, the RNA from pSM1(T7)1b replicated properly in the transfected cells. Superinfection of the transfected cells with standard virus resulted in production of DI particles derived from pSM1(T7)1b and not from pSM1(T7)1a. These observations indicate that deletion RNAs that are inactive replicons have little or no possibility of being genomes of DI particles suggesting the existence of a nonstructural protein(s) that has an inclination to function as a cis-acting protein(s). The method described here will provide a useful technique to investigate genetic information essential for poliovirus replication.     

Poly (rC) binding protein 2 forms a ternary complex with the 5'-terminal sequences of poliovirus RNA and the viral 3CD proteinase.

Poly(rC) binding protein 2 (PCBP2) forms a specific ribonucleoprotein (RNP) complex with the 5'-terminal sequences of poliovirus genomic RNA, as determined by electrophoretic mobility shift assay. Mutational analysis showed that binding requires the wild-type nucleotide sequence at positions 20-25. This sequence is predicted to localize to a specific stem-loop within a cloverleaf-like secondary structure element at the 5'-terminus of the viral RNA. Addition of purified poliovirus 3CD to the PCBP2/RNA binding reaction results in the formation of a ternary complex, whose electrophoretic mobility is further retarded. These properties are consistent with those described for the unidentified cellular protein in the RNP complex described by Andino et al. (Andino R, Rieckhof GE, Achacoso PL, Baltimore D, 1993, EMBO J 12:3587-3598). Dicistronic RNAs containing mutations in the 5' cloverleaf-like structure of poliovirus that abate PCBP2 binding show a decrease in RNA replication and translation of gene products directed by the poliovirus 5' noncoding region in vitro, suggesting that the interaction of PCBP2 with these sequences performs a dual role in the virus life cycle by facilitating both viral protein synthesis and initiation of viral RNA synthesis.     

An RNA hairpin at the extreme 5' end of the poliovirus RNA genome modulates viral translation in human cells.

Several mutations were introduced into an infectious poliovirus cDNA clone by inserting different oligodeoxynucleotide linkers into preexisting DNA restriction endonuclease sites in the viral cDNA. Ten mutated DNAs were constructed whose lesions mapped in the 5' noncoding region or in the capsid coding region of the viral genome. Eight of these mutated cDNAs did not give rise to infectious virus upon transfection into human cells, one yielded virus with a wild-type phenotype, and one gave rise to a viral mutant with a small-plaque phenotype. This last mutant, designated 1-5NC-S21, bears a 6-nucleotide insertion in the loop of a stable RNA hairpin at the very 5' end of the viral genome. Detailed analysis of the biological properties of 1-5NC-S21 showed that the primary defect in mutant-infected cells is a fivefold decrease in translation relative to wild-type-infected cells. Transfection into HeLa cells of in vitro-synthesized RNA molecules bearing either the 5' noncoding region of 1-5NC-S21 or wild-type poliovirus upstream of a luciferase reporter gene showed that the mutated RNA hairpin was responsible for the observed decrease in viral translation in mutant-infected cells and conferred this defect to heterologous RNAs. These findings indicate that an RNA hairpin located at the extreme 5' end of the viral RNA and highly conserved among enteroviruses and rhinoviruses profoundly affects the translation efficiency of poliovirus RNA in infected cells.     

A single base deletion in the 5' noncoding region of Theiler's virus attenuates neurovirulence.

Viral chimeras have been constructed through in vitro manipulations of the infectious cDNA clones of two prototypes of Theiler's murine encephalomyelitis virus: (i) the virulent GDVII strain and (ii) the less virulent BeAn and VL strains. Previous studies have suggested that the phenotypic differences in virulence between the BeAn and GDVII strains map to both the 5' noncoding and the coat protein regions of these viral genomes. It is shown here that attenuation mapped to the 5' noncoding region is due, at least in part, to an inadvertent deletion resulting from a cloning artifact of one C nucleotide out of four between positions 876 and 879 in the BeAn sequences. The in vitro growth characteristics in BHK-21 cells, however, do not reflect the large differences in neurovirulence between chimeras that are identical except for the deleted C. Another chimera with a mutation at position 877 and a deletion at 976 is also attenuated. The wild-type sequences from the less virulent strains BeAn and VL between nucleotides 1 and 933, in an otherwise GDVII chimera, do not attenuate virulence. Sequences of the 500 nucleotides of the 5' noncoding region proximal to the translation initiation codon were obtained for nine additional Theiler's virus strains. The attenuating deletions are discussed in the context of these sequences and the proposed secondary structures for the 5' noncoding region.     

The deletion of 41 proximal nucleotides reverts a poliovirus mutant containing a temperature-sensitive lesion in the 5'' noncoding region of genomic RNA.

We generated a number of small deletions and insertions in the 5' noncoding region of an infectious cDNA copy of the poliovirus RNA genome. Transfection of these mutated cDNAs into COS-1 cells produced the following phenotypic categories: (i) wild-type mutations, (ii) lethal mutations, (iii) mutations exhibiting slow growth or low-titer properties, and (iv) temperature-sensitive (ts) mutations. The deletion of nucleotides 221 to 224 produced a ts virus, 220D1. Mutant 220D1 was found to have a dramatic reduction in growth, virus-specific protein and RNA synthesis, and the shutoff of host cell protein synthesis at 37 or 39 degrees C compared with 33 degrees C. Temperature shift experiments showed that the mutant viral RNA is not an effective template for protein or RNA synthesis at 39 degrees C and suggested a decreased stability of the 220D1 RNA at 39 degrees C. Selection for a non-ts revertant of 220D1 yielded the virus R2, which was no longer ts for growth or viral protein and RNA synthesis. Sequencing the 5' noncoding region of the genomic RNA from R2 revealed the deletion of 41 proximal nucleotides for an overall deletion of nucleotides 184 to 228. These data suggest that the deleted sequences are nonessential to the poliovirus life cycle during growth in HeLa cells. According to computer-predicted RNA secondary structures of the 5' noncoding region of poliovirus RNA, the R2 revertant virus has deleted an entire predicted stem-loop structure.     

The nucleotide sequence of poliovirus type 3 leon 12 a1b: comparison with poliovirus type 1.

The complete nucleotide sequence of the genome of the Sabin vaccine strain of poliovirus type 3 (P3/Leon 12 a1 b) has been determined from cDNA cloned in E. coli. The genome comprises a 5' non-coding region of 742 nucleotides, a large open reading frame of 6618 nucleotides (89% of the sequence) and a 3' non-coding region of 72 nucleotides. There is 77.4% base-sequence homology and 89.6% predicted amino-acid homology between types 1 and 3. Conservation of all glutamine-glycine and tyrosine-glycine cleavage sites suggests a mechanism of polyprotein processing similar to that established for poliovirus type 1.     

Complete nucleotide sequences of all three poliovirus serotype genomes. Implication for genetic relationship, gene function and antigenic determinants

The complete nucleotide sequences of the genomes of the type 2 ( P712 , Ch, 2ab ) and type 3 (Leon 12a1b ) poliovirus vaccine strains were determined. Comparison of the sequences with the previously established genome sequence of type 1 (LS-c, 2ab ) poliovirus vaccine strain revealed that 71% of the nucleotides in the genome RNAs were common, that the 5' and 3' termini of the genomes were highly homologous, and that more than 80% of the nucleotide differences in the coding region occurred in the third letter position of in-phase codons, resulting in a low frequency of amino acid difference. These results strongly suggested that the serotypes of poliovirus derived from a common prototype. A comparison of the amino acid sequences predicted from the genome sequences showed highest variation in the capsid protein region, whereas non-structural proteins are highly conserved. Initiation of polyprotein synthesis occurs in all three strains more than 740 nucleotides downstream from the 5' end. An analysis of the non-coding region suggests that small peptides that could potentially originate from this region are conserved. The amino acid sequences immediately surrounding the cleavage signals, however, show a higher than average degree of variation. The analysis of the amino acid sequences of the capsid protein VP1 of all serotypes has led to the prediction of potential antigenic sites on the virion involved in neutralization.     

An RNA sequence of hundreds of nucleotides at the 5' end of poliovirus RNA is involved in allowing viral protein synthesis.

Twenty-one mutations were engineered in the 5' noncoding region of poliovirus type 1 RNA, using an infectious cDNA copy of the viral genome. RNA was made from these constructs and used to transfect HeLa cells. Viable virus was recovered from 12 of these transfection experiments, including six strains with a recognizable phenotype, mapping in four different regions. One mutant of each site was studied in more detail. Mutant 5NC-11, having a 4-base insertion at nucleotide 70, was dramatically deficient in RNA synthesis, suggesting that the far 5' end of the genome is primarily involved in one or more steps of RNA replication. Mutants 5NC-13, 5NC-114, and 5NC-116, mapping at nucleotides 224, 270, and 392, respectively, showed a similar behavior; they made very little viral protein, they did not inhibit host cell translation, and they synthesized a significant amount of viral RNA, although with some delay compared with wild type. These three mutants were efficiently complemented by all other poliovirus mutants tested, except those with lesions in protein 2A. Our results imply that these three mutants map in a region (region P) primarily involved in viral protein synthesis and that their inability to shut off host cell translation is secondary to a quantitative defect in protein 2A. The exact function of region P is still to be determined, but our data supports the hypothesis of a single functional module allowing viral protein synthesis and extending over several hundred nucleotides.     

Identification of the initiation sequence for viral-strand DNA synthesis of wheat dwarf virus.

The intergenic region of the circular single-stranded DNA genome of geminiviruses contains a sequence potentially able to fold into a stem-loop structure. This sequence has been reported to be involved in viral replication by serving as the origin for rolling-circle replication. However, in wheat dwarf virus (WDV) a deletion of 128 bp, removing this sequence, surprisingly does not prevent de novo viral DNA synthesis, but instead abrogates the processing of replicative intermediates into monomeric genomes. This deletion mutant permitted us to study the initiation of viral-strand DNA synthesis independently from its termination and also to identify the sequence within which rolling-circle DNA replication of WDV begins. We have mapped the initiation site of replication to a pentanucleotide, TACCC, a sequence that occurs twice in the large intergenic region of WDV: it is found in the right half of the stem-loop sequence and again 170 bases upstream where it is part of a 15 nucleotide sequence highly homologous to the right half of the stem-loop sequence. Here we show that viral-strand DNA synthesis efficiently initiates at both sequences.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.