Wright KL,Birnbaum MJ,van Wijnen AJ,Stein GS,Stein JL (1995): Bipartite structure of the proximal promoter of a human H4 histone gene. J Cell Biochem 58:372–379.

The proximal promoter of the human H4 histone gene FO108 contains two regions of in vivo protein-DNA interaction, Sites I and II. electrophoretic, mobility shift assays using a radiolabeled DNA probe revealed that several proteins present in HeLa cell nuclear extracts bound specifically to Site 1 (nt-125 to nt-86). The most prominent complex, designated HiNF-C, and a complex of greater mobility, HiNF-C′, using were specifically competed by an Sp1 consensus oligonucleotide. Fractionation of HiNF-C using wheat germ agglutinin affinity chromatography suggested that, like Sp1, HiNF-C contains N-acetylglucosamine moieties. Two minor complexes of even greater mobility, designated HiNF-E and F, were competed by ATF consensus oligonucleotides. A DNA probe carrying a site-specific mutation in the distal portion of Site I failed to bind HiNF-E, indicating that this protein associated specifically to this region. UV cross-linking analysis showed that several proteins of different molecular wieghts interact specifically with Site I. These data indicate that Site I possesses as bipartite structure and that multiple proteins present in HeLa cell nuclear extracts interact specifically with Site I sequences. © 1995 Wiley-Liss, Inc.     

Similar actions of glucocorticoids and calcium on the regulation of apoptosis in S49 cells

Glucocorticoid-induced lymphocyte cell death is a programmed process which is thought to involve the calcium-dependent degradation of DNA into multiples of 180 basepairs, characteristic of internucleosomal degradation. We have used the glucocorticoid-sensitive mouse lymphoma cell line S49.1 [wild-type (wt)] and the glucocorticoid-resistant cell line S49.22r (nt-) to evaluate the role of both glucocorticoid receptors and calcium in the regulation of internucleosomal DNA degradation and expression of calcium-dependent deoxyribonuclease activity. DNA was isolated from untreated (control) and dexamethasone (dex)-treated viable cells and analyzed for internucleosomal DNA degradation by agarose gel electrophoresis, followed by ethidium bromide staining. Glucocorticoid treatment resulted in substantial internucleosomal DNA degradation in wt cells, but not in nt- cells. This effect was inhibited by coincubation of cells with dex and the glucocorticoid receptor antagonist RU486. In contrast to the glucocorticoid response, administration of either of two calcium ionophores, ionomycin or A23187, produced internucleosomal degradation of DNA in both wt and nt- cells, although the latter were less sensitive to ionophore treatment. Interestingly, A23187 treatment also resulted in a loss of cell viability in HeLa S3 cells, a cell line that does not exhibit glucocorticoid-induced apoptosis. No internucleosomal DNA degradation was detected in HeLa S3 cells killed by A23187. To determine whether similar nucleases are associated with this internucleosomal DNA degradation resulting from both glucocorticoid and calcium ionophore treatment, 0.3 M NaCl nuclear protein extracts were prepared from control and treated cells and analyzed for protein composition or nuclease activity. To assay for nuclease activity, nuclear extracts were electrophoresed in sodium dodecyl sulfate-polyacrylamide gels impregnated with [32P]DNA. Nuclease activity was detected by removal of sodium dodecyl sulfate from the gel, activation with calcium, and subsequent visualization of the loss of [32P]DNA by autoradiography. Dex treatment of wt cells resulted in the appearance of several proteins within the mol wt range of 12-18 kDa, only one of which (16-18 kDa) exhibited calcium-dependent nuclease activity. The appearance of these proteins in nuclear extracts was inhibited by coincubation of glucocorticoid-treated cells with RU 486. Glucocorticoid treatment did not result in the appearance of nuclease activity in nuclear extracts from nt- cells. Interestingly, A23187 or ionomycin treatment resulted in an increase in activity of the 16- to 18-kDa nuclease in both wt and nt- cells. These findings indicate that both glucocorticoid receptors and calcium may share common features in the regulation of apoptosis in lymphoid cells.     

Specific binding of Alu sequences by HeLa nuclear extracts

Plasmid Blur 8 which contains the 300bp human Alu consensus sequence and plasmid pBR322 were digested with restriction enzymes and the fragments obtained end labelled with 32P-gamma-ATP. The end labelled fragments were incubated with HeLa nuclear extracts and the incubation mixtures passed through a nitrocellulose filter. The 300bp alu consensus sequence was preferentially retained on the filter. The HeLa nuclear extract did not preferentially bind any fragments generated from pBR322 and histones which bind nonspecifically all DNA fragments did not preferentially bind the alu sequence. We conclude that the HeLa nuclear extract contains components which specifically bind the human alu sequence.     

Targeting of Sp1 to a non-Sp1 site in the human neurofilament (H) promoter via an intermediary DNA-binding protein.

The human neurofilament (H) promoter contains multiple binding sites for nuclear proteins including a Proximal (Prox) site centered around the sequence GGTTGGACC and an adjacent pyrimidine (Pyr) tract site centered around the sequence CCCTCCTCCCC. Surprisingly binding to a probe containing the Prox/Pyr region of the NF(H) promoter was competed in gel shifts by an oligonucleotide containing only an Sp1 binding site (GGGGCGGGG). Supershift assays with a polyclonal anti-Sp1 antisera confirmed that Sp1 was part of the complex formed with the Prox/Pyr probe. However neither bacterially expressed Sp1 516C or vaccinia virus expressed full-length Sp1 778C bound to the Prox or Pyr sequences in DNase I footprints or gel shift assays. Gel shift competitions and supershift assays with probes containing either Prox or Pyr tract sites alone demonstrated targeting of Sp1 to the Prox binding site and identified a non-Sp1 containing complex which contains a Prox binding protein. Adding exogenous Sp1 to a HeLa nuclear extract enhanced the Sp1-containing complex but had no effect on the Prox complex. These studies show that Sp1 can be targeted to a non-Sp1 site in the human NF(H) promoter through protein/protein interactions with a distinct sequence specific DNA-binding protein.     

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

Cell cycle-dependent dynamic association of cyclin/Cdk complexes with human DNA replication proteins

We have previously described the isolation of a replication competent (RC) complex from calf thymus, containing DNA polymerase alpha, DNA polymerase delta and replication factor C. Here, we describe the isolation of the RC complex from nuclear extracts of synchronized HeLa cells, which contains DNA replication proteins associated with cell-cycle regulation factors like cyclin A, cyclin B1, Cdk2 and Cdk1. In addition, it contains a kinase activity and DNA polymerase activities able to switch from a distributive to a processive mode of DNA synthesis, which is dependent on proliferating cell nuclear antigen. In vivo cross-linking of proteins to DNA in synchronized HeLa cells demonstrates the association of this complex to chromatin. We show a dynamic association of cyclins/Cdks with the RC complex during the cell cycle. Indeed, cyclin A and Cdk2 associated with the complex in S phase, and cyclin B1 and Cdk1 were present exclusively in G(2)/M phase, suggesting that the activity, as well the localization, of the RC complex might be regulated by specific cyclin/Cdk complexes.