Rescue of a Dominant Mutant With RNA Interference

Maize Mucronate1 is a dominant floury mutant based on a misfolded 16-kDa γ-zein protein. To prove its function, we applied RNA interference (RNAi) as a dominant suppressor of the mutant seed phenotype. A γ-zein RNAi transgene was able to rescue the mutation and restore normal seed phenotype. RNA interference prevents gene expression. In most cases, this is used to study gene function by creating a new phenotype. Here, we use it for the opposite purpose. We use it to reverse the creation of a mutant phenotype by restoring the normal phenotype. In the case of the maize Mucronate1 (Mc1) phenotype, interaction of a misfolded protein with other proteins is believed to be the basis for the Mc1 phenotype. If no misfolded protein is present, we can reverse the mutant to the normal phenotype. One can envision using this approach to study complex traits and in gene therapy.TRANSLUCENT or vitreous maize kernels are harder and able to sustain stronger mechanical strength during harvesting, transportation, and storage. There is a direct link between a vitreous seed phenotype and the type of storage proteins in the seed, collectively called zeins in maize. Zeins, encoded by a multigene family, constitute >60% of all maize seed proteins. They are classified into four groups (α-, β-, γ-, and δ-zein) on the basis of their structures (Esen 1987). Zeins are specifically synthesized in the endosperm ∼10 days after pollination (DAP) and deposited into protein bodies (Wolf et al. 1967; Burr and Burr 1976; Lending and Larkins 1992). Irregularly shaped protein bodies are found in floury or opaque kernel phenotypes (Coleman et al. 1997; Kim et al. 2004, 2006; Wu et al. 2010; Wu and Messing 2010). The terms “floury” and “opaque” were originally created on the basis of the genetic behaviors of the mutant allele causing the soft kernel texture. The floury mutants behave as semidominant or dominant mutants, as floury1 and floury2 do, while the opaque mutants are recessive, as opaque1 and opaque2 are (Hayes and East 1915; Lindstrom 1923; Emerson et al. 1935; Maize Genetics Cooperation 1939). Similar to floury2 with a single mutation in the signal peptide of a 22-kDa α-zein resulting in an unprocessed protein (Coleman et al. 1995), De*-B30 produces an unprocessed 19-kDa α-zein (Kim et al. 2004). It was hypothesized that the two mutant proteins with an unprocessed signal peptide are misfolded and docked in the membranes of the rough endoplasmic reticulum (RER), blocking the deposition of other zein proteins (Coleman et al. 1995; Kim et al. 2004). In Mucronate1 (Mc1), a 38-bp deletion in the C terminus of the 16-kDa γ-zein (γ16-zein) gene resulted in a frameshift and a protein with a different amino-acid tail. This modified 16-kDa γ-zein (Δγ16-zein) has altered solubility properties, which would explain the formation of irregular protein bodies. Because De*-B30 and Mc1 are semidominant and dominant, respectively, they belong to the floury mutant class.The γ-zein genes (γ27-zein and γ16-zein) are homologous copies because maize underwent allotetraploidization and both gene copies have been retained during diploidization (Xu and Messing 2008). The two γ-zeins and the 15-kDa β-zein have a redundant function in stabilizing protein-body formation (Wu and Messing 2010). Knockdown of both γ-zeins with a single RNA interference (RNAi) construct conditioned only partial opacity in the crown, the top of the kernel, as opposed to the remainder or gown area of the kernel. Consistent with its light kernel phenotype, protein bodies in such a γ-zein RNAi (γRNAi) mutant exhibited a slight alteration in morphology. This phenotype is clearly distinguishable from the Mc1 phenotype, which is far more severe. Therefore, if Mc1 is caused by a misfolded chimeric 16-kDa γ-zein, preventing its expression should restore normal kernel phenotype. Indeed, a simple cross of Mc1 with a maize line carrying the γRNAi transgene produced a non-floury phenotype, providing an example of RNAi as a dominant suppressor of a dominant phenotype and as a general tool in marker rescue.

Analysis of the progeny from the cross of Mc1 and γRNAi mutants:

Mc1 seeds (Stock ID U840I) were requested from the Maize Genetics Cooperation Stock Center. The γRNAi transgenic lines have been reported in previous work (Wu et al. 2010; Wu and Messing 2010). Twelve progeny kernels from the cross of the Mc1 mutant [homozygous for the dominant-negative mutant 16-kDa γ-zein alleles (Δγ16/Δγ16) and heterozygous for the γRNAi line (γRNAi/+)] were dissected at 18 DAP for segregation and mRNA accumulation analyses. For each kernel, the embryo and endosperm were separated for DNA and RNA extraction, respectively. As shown in Figure 1A, five and seven kernels were positive and negative for the amplification of the γRNAi gene with a specific primer set, exemplifying a 1:1 segregation of the γRNAi gene.Open in a separate windowFigure 1.—Segregation analysis of the accumulations of mRNAs and proteins from the cross of the Mc1 mutant and the γRNAi line by RT–PCR and SDS–PAGE. (A) γRNAi gene segregation from progeny (Δγ16/Δγ16 x γRNAi/+) by PCR amplification with a specific primer set (GFPF, ACAACCACTACCTGAGCAC and T35SHindIII, ATTAAGCTTTGCAGGTCACTGGATTTTGG). Kernels 3, 8, 9, 10, and 12 are positive for the γRNAi gene and the rest of them are negative. M, DNA markers from top to bottom band are 3, 2, 1.5, 1.4, and 1 kb. (B) RT–PCR analysis of mRNA accumulation from the normal γ16 and mutant Δγ16 alleles in the endosperms with the genotypes corresponding to the embryos analyzed above. Total RNA was extracted by using TRIzol reagent (Invitrogen). Two micrograms of RNA was digested with DNase I (Invitrogen) and then reverse-transcribed. Twenty-five nanograms of cDNA from each of the twelve endosperms was applied for PCR (25 cycles of 30 sec, 94 °C; 30 sec, 58 °C; and 1 min, 72 °C). A specific primer set (γ16F, ATGAAGGTGCTGATCGTTGC and γ16R, TCAGTAGTAGACACCGCCG) was designed for amplification of the full-length γ16-zein coding sequence (552 bp). The lower band (514 bp) from the mutant Δγ16 allele is 38 bp shorter than that from the normal allele (552 bp). Kernels 3, 8, 9, 10, and 12 with the γRNAi gene accumulated significantly less mRNA compared to those without the γRNAi gene (kernels 1, 2, 4, 5, 6, 7, and 11). BA, hybrid of B × A lines. M, DNA markers from top to bottom are 1 kb, 750 bp, and 500 bp. (C) Profile of zein accumulations of 20 kernels from the progeny as described in the text. The zein extraction method has been described elsewhere (Wu et al. 2009). The Δγ16-zein from Mc1 was not extracted by traditional total-zein extraction protocol (70% ethanol and 2% 2-mercaptoethanol). The γ27- and γ16-zeins were knocked down to a nondetectable level in kernels 1, 2, 3, 5, 7, 10, 12, 13, 16, and 20. In γRNAi-gene segregating progeny (kernels 4, 6, 8, 9, 11, 14, 15, 17, 18, and 19), the γ16-zein from the normal γ16 allele is marked by arrowheads. Protein loaded in each lane was equal to 500 μg fresh endosperm at 18 DAP. The size for each band is indicated by the numbers in the “kDa” columns. BA, hybrid of B × A lines; 1–20, kernels from the progeny described above; M, protein markers from top to bottom are 50, 25, 20, and 15 kDa.Due to the 38-bp deletion in the C terminus of the coding region, the Δγ16 allele is shorter than the normal one (Figure 1B). Therefore, most of Δγ16-zein was in the non-zein fraction. In progeny endosperms of another 20 kernels from the same cross described above segregating for the γRNAi gene, two types of γ16-zeins were synthesized: the normal γ16-zein in the ethanol-soluble zein fraction and the Δγ16-zein in the non-zein fraction. In progeny inheriting the γRNAi gene, the γ27- and γ16-zeins were reduced to nondetectable levels (Figure 1C). Although the Δγ16-zein is not in the ethanol-soluble zein fraction, the level of normal γ16-zein is a good indicator of the accumulation of the Δγ16-zein.

Rescue of protein-body morphologies in the Mc1 mutant:

Regular protein bodies are round with distinct membrane boundaries (Figure 2A) and 1–2 μm in diameter at maturity. In homozygous and heterozygous Mc1 mutants (Δγ16/Δγ16 and Δγ16/+), protein bodies were irregularly shaped, some without discrete boundaries (Figure 2, C and D), which is quite different from the absence of normal γ27- or γ16-zeins in maize endosperm (Figure 2B). Indeed, protein bodies of the Mc1 mutant, blocked in the accumulation of Δγ16-zein, showed morphologies with no discernible difference from those in the γRNAi/+ line (Figure 2, B and E).Open in a separate windowFigure 2.—Transmission electron micrographs of protein bodies. The method has been described elsewhere (Wu and Messing 2010). (A) Nontransgenic BA. (B) γRNAi transgenic line (γRNAi/+). (C) Mc1 (Δγ16/Δγ16). (D) Cross of Mc1 mutant and nontransgenic hybrid of B × A lines (Δγ16/+). (E) Cross of Mc1 mutant (Δγ16/Δγ16) and heterologous γRNAi transgenic line (γRNAi/+). PB, protein body; RER, rough endoplasmic reticulum; CW, cell wall; Mt, mitochondria; SG, starch granule. Bars, 500 nm.

Recovery of floury phenotype in progeny:

On the basis of these observations, it is reasoned that irregularly shaped protein bodies (Figure 2, C and D) in the Mc1 mutant cause the floury phenotype (Figure 3, A and B). Because knockdown of γ-zeins caused opacity only in the crown area (Figure 3C), one could envision that once the irregular protein bodies are restored, the kernel would become vitreous in the gown area of the kernel. Indeed, the progeny ear from the cross of Δγ16/Δγ16 and γRNAi/+ showed a 1:1 ratio of floury and vitreous kernels (Figure 3, D and F), and all kernels were vitreous when the Mc1 mutant was pollinated by a homozygous γRNAi line (Figure 3E).Open in a separate windowFigure 3.—Segregation of vitreous and floury kernels from a progeny ear. (A) Mc1 mutant with Δγ16/Δγ16 genotype. (B) The cross of the Mc1 mutant and the nontransgenic hybrid of B × A lines, showing floury phenotype as in A. (C) γRNAi transgenic line with partial opacity only in the crown area. (D) The cross of the Mc1 mutant (Δγ16/Δγ16) and the heterologous γRNAi transgenic line (γRNAi/+), showing a 1:1 ratio of vitreous and floury kernels. A row in the ear is marked with arrowheads and crosses to indicate vitreous and floury gowns of kernels. (E) Cross of the Mc1 mutant (Δγ16/Δγ16) and the γRNAi homozygous transgenic line (γRNAi/γRNAi), showing all vitreous kernels. (F) Truncated kernel phenotype. (Top) Mc1, cross of Mc1 × BA, and γRNAi transgenic line. (Bottom) Three vitreous and floury kernels from D.

Conclusions:

RNAi can be used to rescue mutations that are dominant negative with a single cross, providing a useful tool in genetic analysis, plant breeding, and potentially in gene therapy in general.     

The Nuclear Receptor Peroxisome Proliferator-activated Receptor-β/δ (PPARβ/δ) Promotes Oncogene-induced Cellular Senescence through Repression of Endoplasmic Reticulum Stress

Endoplasmic reticulum (ER) stress and ER stress-associated unfolded protein response (UPR) can promote cancer cell survival, but it remains unclear whether they can influence oncogene-induced senescence. The present study examined the role of ER stress in senescence using oncogene-dependent models. Increased ER stress attenuated senescence in part by up-regulating phosphorylated protein kinase B (p-AKT) and decreasing phosphorylated extracellular signal-regulated kinase (p-ERK). A positive feed forward loop between p-AKT, ER stress, and UPR was discovered whereby a transient increase of ER stress caused reduced senescence and promotion of tumorigenesis. Decreased ER stress was further correlated with increased senescence in both mouse and human tumors. Interestingly, H-RAS-expressing Pparβ/δ null cells and tumors having increased cell proliferation exhibited enhanced ER stress, decreased cellular senescence, and/or enhanced tumorigenicity. Collectively, these results demonstrate a new role for ER stress and UPR that attenuates H-RAS-induced senescence and suggest that PPARβ/δ can repress this oncogene-induced ER stress to promote senescence in accordance with its role as a tumor modifier that suppresses carcinogenesis.     

Calcineurin Interacts with PERK and Dephosphorylates Calnexin to Relieve ER Stress in Mammals and Frogs

Background

The accumulation of misfolded proteins within the endoplasmic reticulum (ER) triggers a cellular process known as the Unfolded Protein Response (UPR). One of the earliest responses is the attenuation of protein translation. Little is known about the role that Ca²⁺ mobilization plays in the early UPR. Work from our group has shown that cytosolic phosphorylation of calnexin (CLNX) controls Ca²⁺ uptake into the ER via the sarco-endoplasmic reticulum Ca²⁺-ATPase (SERCA) 2b.

Methodology/Principal Findings

Here, we demonstrate that calcineurin (CN), a Ca²⁺ dependent phosphatase, associates with the (PKR)-like ER kinase (PERK), and promotes PERK auto-phosphorylation. This association, in turn, increases the phosphorylation level of eukaryotic initiation factor-2 α (eIF2-α) and attenuates protein translation. Data supporting these conclusions were obtained from co-immunoprecipitations, pull-down assays, in-vitro kinase assays, siRNA treatments and [³⁵S]-methionine incorporation measurements. The interaction of CN with PERK was facilitated at elevated cytosolic Ca²⁺ concentrations and involved the cytosolic domain of PERK. CN levels were rapidly increased by ER stressors, which could be blocked by siRNA treatments for CN-Aα in cultured astrocytes. Downregulation of CN blocked subsequent ER-stress-induced increases in phosphorylated elF2-α. CN knockdown in Xenopus oocytes predisposed them to induction of apoptosis. We also found that CLNX was dephosphorylated by CN when Ca²⁺ increased. These data were obtained from [γ³²P]-CLNX immunoprecipitations and Ca²⁺ imaging measurements. CLNX was dephosphorylated when Xenopus oocytes were treated with ER stressors. Dephosphorylation was pharmacologically blocked by treatment with CN inhibitors. Finally, evidence is presented that PERK phosphorylates CN-A at low resting levels of Ca²⁺. We further show that phosphorylated CN-A exhibits decreased phosphatase activity, consistent with this regulatory mechanism being shut down as ER homeostasis is re-established.

Conclusions/Significance

Our data suggest two new complementary roles for CN in the regulation of the early UPR. First, CN binding to PERK enhances inhibition of protein translation to allow the cell time to recover. The induction of the early UPR, as indicated by increased P-elF2α, is critically dependent on a translational increase in CN-Aα. Second, CN dephosphorylates CLNX and likely removes inhibition of SERCA2b activity, which would aid the rapid restoration of ER Ca²⁺ homeostasis.     

Arabidopsis Stromal-derived Factor2 (SDF2) Is a Crucial Target of the Unfolded Protein Response in the Endoplasmic Reticulum

Stresses increasing the load of unfolded proteins that enter the endoplasmic reticulum (ER) trigger a protective response termed the unfolded protein response (UPR). Stromal cell-derived factor2 (SDF2)-type proteins are highly conserved throughout the plant and animal kingdoms. In this study we have characterized AtSDF2 as crucial component of the UPR in Arabidopsis thaliana. Using a combination of biochemical and cell biological methods, we demonstrate that SDF2 is induced in response to ER stress conditions causing the accumulation of unfolded proteins. Transgenic reporter plants confirmed induction of SDF2 during ER stress. Under normal growth conditions SDF2 is highly expressed in fast growing, differentiating cells and meristematic tissues. The increased production of SDF2 due to ER stress and in tissues that require enhanced protein biosynthesis and secretion, and its association with the ER membrane qualifies SDF2 as a downstream target of the UPR. Determination of the SDF2 three-dimensional crystal structure at 1.95 Å resolution revealed the typical β-trefoil fold with potential carbohydrate binding sites. Hence, SDF2 might be involved in the quality control of glycoproteins. Arabidopsis sdf2 mutants display strong defects and morphological phenotypes during seedling development specifically under ER stress conditions, thus establishing that SDF2-type proteins play a key role in the UPR.     

New Methods for Extraction and Quantitation of Zeins Reveal a High Content of gamma-Zein in Modified opaque-2 Maize

We have developed methods for quantitative extraction and analysis of zeins from maize (Zea mays L.) flour. Extraction involved solubilization of total endosperm proteins in an alkaline buffer containing SDS and 2-mercaptoethanol with subsequent precipitation of nonzein proteins by the addition of ethanol to 70%. Analysis of these proteins by SDS-PAGE with Coomassie blue staining and by Western blotting and ELISA assay with zein antibodies revealed that this extraction method is more quantitative than the traditional Landry-Moureaux procedure, especially for the β- and γ-zeins. This method was used to extract and analyze the zein content of several `Quality Protein Maize' (QPM) varieties developed by the International Maize and Wheat Improvement Center. QPM varieties contain `modifier genes' that confer a vitreous phenotype on opaque-2 genotypes, while maintaining the elevated levels of lysine and tryptophan characteristic of this mutant. This analysis revealed that the QPM types contain 2 to 4 times the amount of the γ-zein than unmodified opaque-2 or normal maize varieties. Possible relationships between the high expression of the γ-zein and the modified opaque phenotype are discussed.     

Endoplasmic reticulum‐mediated unfolded protein response is an integral part of singlet oxygen signalling in plants

Singlet oxygen (¹O₂) is a by‐product of photosynthesis that triggers a signalling pathway leading to stress acclimation or to cell death. By analyzing gene expressions in a ¹O₂‐overproducing Arabidopsis mutant (ch1) under different light regimes, we show here that the ¹O₂ signalling pathway involves the endoplasmic reticulum (ER)‐mediated unfolded protein response (UPR). ch1 plants in low light exhibited a moderate activation of UPR genes, in particular bZIP60, and low concentrations of the UPR‐inducer tunicamycin enhanced tolerance to photooxidative stress, together suggesting a role for UPR in plant acclimation to low ¹O₂ levels. Exposure of ch1 to high light stress ultimately leading to cell death resulted in a marked upregulation of the two UPR branches (bZIP60/IRE1 and bZIP28/bZIP17). Accordingly, mutational suppression of bZIP60 and bZIP28 increased plant phototolerance, and a strong UPR activation by high tunicamycin concentrations promoted high light‐induced cell death. Conversely, light acclimation of ch1 to ¹O₂ stress put a limitation in the high light‐induced expression of UPR genes, except for the gene encoding the BIP3 chaperone, which was selectively upregulated. BIP3 deletion enhanced Arabidopsis photosensitivity while plants treated with a chemical chaperone exhibited enhanced phototolerance. In conclusion, ¹O₂ induces the ER‐mediated UPR response that fulfils a dual role in high light stress: a moderate UPR, with selective induction of BIP3, is part of the acclimatory response to ¹O₂, and a strong activation of the whole UPR is associated with cell death.     

Hyperactivity of the Ero1α Oxidase Elicits Endoplasmic Reticulum Stress but No Broad Antioxidant Response

Oxidizing equivalents for the process of oxidative protein folding in the endoplasmic reticulum (ER) of mammalian cells are mainly provided by the Ero1α oxidase. The molecular mechanisms that regulate Ero1α activity in order to harness its oxidative power are quite well understood. However, the overall cellular response to oxidative stress generated by Ero1α in the lumen of the mammalian ER is poorly characterized. Here we investigate the effects of overexpressing a hyperactive mutant (C104A/C131A) of Ero1α. We show that Ero1α hyperactivity leads to hyperoxidation of the ER oxidoreductase ERp57 and induces expression of two established unfolded protein response (UPR) targets, BiP (immunoglobulin-binding protein) and HERP (homocysteine-induced ER protein). These effects could be reverted or aggravated by N-acetylcysteine and buthionine sulfoximine, respectively. Because both agents manipulate the cellular glutathione redox buffer, we conclude that the observed effects of Ero1α-C104A/C131A overexpression are likely caused by an oxidative perturbation of the ER glutathione redox buffer. In accordance, we show that Ero1α hyperactivity affects cell viability when cellular glutathione levels are compromised. Using microarray analysis, we demonstrate that the cell reacts to the oxidative challenge caused by Ero1α hyperactivity by turning on the UPR. Moreover, this analysis allowed the identification of two new targets of the mammalian UPR, CRELD1 and c18orf45. Interestingly, a broad antioxidant response was not induced. Our findings suggest that the hyperoxidation generated by Ero1α-C104A/C131A is addressed in the ER lumen and is unlikely to exert oxidative injury throughout the cell.     

Dietary Fish Oil Inhibits Pro-Inflammatory and ER Stress Signalling Pathways in the Liver of Sows during Lactation

Lactating sows have been shown to develop typical signs of an inflammatory condition in the liver during the transition from pregnancy to lactation. Hepatic inflammation is considered critical due to the induction of an acute phase response and the activation of stress signaling pathways like the endoplasmic reticulum (ER) stress-induced unfolded protein response (UPR), both of which impair animal´s health and performance. Whether ER stress-induced UPR is also activated in the liver of lactating sows and whether dietary fish oil as a source of anti-inflammatory effects n-3 PUFA is able to attenuate hepatic inflammation and ER stress-induced UPR in the liver of sows is currently unknown. Based on this, two experiments with lactating sows were performed. The first experiment revealed that ER stress-induced UPR occurs also in the liver of sows during lactation. This was evident from the up-regulation of a set of genes regulated by the UPR and numerically increased phosphorylation of the ER stress-transducer PERK and PERK-mediated phosphorylation of eIF2α and IκB. The second experiment showed that fish oil inhibits ER stress-induced UPR in the liver of lactating sows. This was demonstrated by decreased mRNA levels of a number of UPR-regulated genes and reduced phosphorylation of PERK and PERK-mediated phosphorylation of eIF2α and IκB in the liver of the fish oil group. The mRNA levels of various nuclear factor-κB-regulated genes encoding inflammatory mediators and acute phase proteins in the liver of lactating sows were also reduced in the fish oil group. In line with this, the plasma levels of acute phase proteins were reduced in the fish oil group, although differences to the control group were not significant. In conclusion, ER stress-induced UPR is present in the liver of lactating sows and fish oil is able to inhibit inflammatory signaling pathways and ER stress-induced UPR in the liver.     

Direct Association of Unfolded Proteins with Mammalian ER Stress Sensor,IRE1β

IRE1, an ER-localized transmembrane protein, plays a central role in the unfolded protein response (UPR). IRE1 senses the accumulation of unfolded proteins in its luminal domain and transmits a signal to the cytosolic side through its kinase and RNase domains. Although the downstream pathways mediated by two mammalian IRE1s, IRE1α and IRE1β, are well documented, their luminal events have not been fully elucidated. In particular, there have been no reports on how IRE1β senses the unfolded proteins. In this study, we performed a comparative analysis to clarify the luminal event mediated by the mammalian IRE1s. Confocal fluorescent microscopy using GFP-fused IRE1s revealed that IRE1β clustered into discrete foci upon ER stress. Also, fluorescence correlation spectroscopy (FCS) analysis in living cells indicated that the size of the IRE1β complex is robustly increased upon ER stress. Moreover, unlike IRE1α, the luminal domain of IRE1β showed anti-aggregation activity in vitro, and IRE1β was coprecipitated with the model unfolded proteins in cells. Strikingly, association with BiP was drastically reduced in IRE1β, while IRE1α was associated with BiP and dissociated upon ER stress. This is the first report indicating that, differently from IRE1α, the luminal event mediated by IRE1β involves direct interaction with unfolded proteins rather than association/dissociation with BiP, implying an intrinsic diversity in the sensing mechanism of mammalian sensors.