Structure of a bacterial photosynthetic membrane: integrity of reaction centers following proteolysis and detergent solubilization

cDNAs were molecularly cloned for proteins specifically expressed in embryo as well as in a chemically induced rat pancreatic B cell tumor in which virally related oncogenes such as v-myc, v-src, v-yes, v-mos and v-kis were previously demonstrated not to be expressed. A plasmid cDNA library consisting of 48,000 independent colonies was constructed from poly(A) containing cytoplasmic RNA isolated from 12 day rat embryo. The library was screened by hybridization with 32p-labelled cDNA synthesized from poly(A) containing RNA of rat pancreatic B cell tumor or normal islet B cells. Two clones were obtained which showed a clearly positive reaction only with tumor probe. Nucleotide sequence of one of them harboring insert of 615 nucleotides was determined and its amino acid sequence of 119 residues was deduced, which showed that the protein encoded by this mRNA is highly basic, basic residues/acidic residues being 1.63.     

Divergence of tRNA genes in chloroplast DNA of higher plants

The saturation hybridization between spinach chloroplast (ct) DNA and spinach ¹²⁵I-labelled chloroplast tRNA has shown that about 1.1% of the spinach ctDNA codes for tRNAs. The observed hybridization is a result of specific base-pairing as shown by competition hybridization experiments and thermal stability of the ctDNA-tRNA hybrids. The amount of hybridization shows that spinach ctDNA contains about 40 tRNA genes. Similar hybridization studies have shown that corn ctDNA contains about 28 tRNA genes. The cross-hybridizations between ctDNA and tRNAs of corn, spinach and pea have shown that tRNAs in chloroplasts of higher plants have undergone significant divergence. The pea and spinach tRNAs have been found to have 50% of the base sequences in common. The corn tRNAs have been found to have only about 30% of the base sequences in common with pea and spinach. These data have been confirmed by extensive heterologous competition experiments and thermal stability of the heterologous DNA-tRNA hybrids. The experiments have also shown that the base sequences of tRNAs common in all three plants are the same.     

Restriction mapping of the rRNA genes from Artemia larvae

A restriction endonuclease analysis of the genes coding for the ribosomal RNA from Artemia larvae has shown that these genes consist of a repeat unit of 16.2 kilobase pairs (10.7 Mdaltons) and that the repeat unit seems to be homogeneous in size.     

Analysis of the membrane-associated poly(A)+RNA in the cytoplasm of dormant Artemia cysts by DNA excess hybridization: Evidence for a nuclear origin

Encysted embryos of Artemia contain latent mRNA, to a large extent associated with a fraction of cytoplasmic membranes. The membranes, purified by EDTA treatment and banding in a sucrose gradient at 1.17 g/cm³, include endoplasmic vesicles and mitochondria. The origin of the membrane-associated poly(A)⁺RNA was therefore investigated. In gel electrophoresis poly(A)⁺RNA from the purified membranes of dormant cysts forms two distinct bands at approx. 3·10⁵ and 5·10⁵ Da. Later during development the lighter component decreases. Nuclei from dormant cysts are devoid of poly(A)⁺RNA, while nuclei from developing embryos (50% emergence) contain a predominant poly(A)⁺RNA component of approx. 5·10⁵ Da. ¹²⁵I-labelled preparations of nuclear DNA and of nuclear and membrane-associated poly(A)⁺RNA were used in reassociation and hybridization experiments with excess nuclear DNA. Poly(A)⁺RNA from the membranes of dormant cysts hybridized to nuclear DNA to the same extent as the nuclear poly(A)⁺RNA from developing embryos. The hybridization of labelled, nuclear poly(A)⁺RNA to nuclear DNA was strongly inhibited by unlabelled membrane RNA from either dormant cysts or developing embryos. It is concluded that the stored, membrane-associated poly(A)⁺RNA in dormant cysts is essentially of nuclear origin. The 5·10⁵-Da component is largely homologous with the corresponding component of nuclear poly(A)⁺RNA at later stages.     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

Reassociation of human lymphoblastoid cell DNA repair replicated following methyl methanesulfonate treatment

The reassociation rates of repair replicated DNA of two human lymphoblastoid cell lines, the WIL₂-A3 ‘normal’ line and the RAJI line of Burkitt's lymphoma, were examined using the DNA/DNA ‘C₀t’ hybridization technique. The cells were treated with methyl methanesulfonate (MMS), an alkylating agent and mutagen, to induce the repair.The incorporated repair replication radioactivity in highly repetitive sequences of WIL₂-A3 cell DNA reassociates as expected for a randomly distributed incorporation. The reassociation of repair radioactivity in sequences of fewer numbers of copies, however, is less than expected for a random distribution. It is less than that occurring for semiconservatively synthesized DNA of WIL₂-A3 cells co-incubated with the repair labeled DNA as an internal control.The observed difference could be due to an over-representation of repair replication radioactivity in DNA sequences with fewer copies. It is unlikely to be due to residual alkali labile damage resulting from MMS treatment, since a similar difference was not observed when semiconservatively labeled DNA from cells which had been treated with MMS for the same time and at the same concentration as in the repair experiments was substituted for repair replicated DNA in the reassociation reactions. Other possible causes of the apparent difference in the reassociation rates observed are discussed.     

Cloning of genes for bacteriophage T5 stable RNAs

One EcoRI-generated fragment (440 basepairs) and two EcoRI/HindIII fragments (220 and 960 basepairs) from the deletion region of T5 phage have been inserted into the phage λ XIII and the plasmid pBR322 as vectors. Recombinant DNA molecules were studied by hybridization with in vivo ³²P-labeled T5 4–5 S RNAs on nitrocellulose filters. Two-dimensional polyacrylamide gel electrophoretic fractionation and fingerprint analysis of the RNAs eluted from the filters were carried out to identify RNAs coded by cloned fragments. For the accurate localization of the genes for these RNAs, RNA-DNA hybrids were treated with T1 and pancreatic RNAases, and the eluted RNA fragments stable against RNAase action were electrophoresed. It was shown that the EcoRI¹440 fragment contains the gene for tRNA 10 (tRNA^Asp), the EcoRI/HindIII¹220 fragment contains the gene for RNA III (107 bases) and parts of the genes for RNA I (107 bases) and tRNA 12 (tRNA^His), and the EcoRI/HindIII¹960 fragment contains only a part of the gene for tRNA 9 (tRNA^Gln). The arrangement of these genes on the physical map of T5 phage was as follows: -tRNA^Gln-tRNA^His-RNA III-RNA I-…-tRNA^Asp.     

Characterization of a Drosophila repeat mapping at the early-ecdysone puff 63F and present in many eucaryotic genomes

In this report we describe the nucleotide sequence of a 229 bp tandemly repeated sequence that hybridizes in situ to the early-ecdysone puff site 63F on salivary gland polytene chromosome 3 (Izquierdo, M., Arribas, C. and Alonso, C. (1981) Chromosoma 83, 363–366). Restriction analysis of genomic clones from the region indicates the existence of a minimum of 15 copies tandemly arranged at two separated sites, within the 63F puff region. The 229 basic units include conserved and variable segments and have two possible open-reading frames. A slight variation in the length of basic repeats was also observed. Some fly-stocks from Drosophila melanogaster contain particular RNA size classes complementary to the 63F repeat, while other RNAs remain constant in all stocks analyzed. A 5 kb fragment containing the repeat is present in many eucaryotic living beings, including plants and humans.     

Sequence of the cryptic satellite DNA from the plant Sinapis alba

A satellite DNA with a buoyant density equal to that of main band DNA in neutral cesium chloride (‘cryptic satellite’) can be isolated from the DNA of mustard (Sinapis alba) nuclei by Ag⁺/Cs₂SO₄ density gradient centrifugation. This satellite is cleaved into 172 bp repeat units by HinfI, AluI or HaeIII. The HinfI fragments have been further cleaved by AluI, and seven AluI subfragments have been sequenced. As a result two versions of a basic 172 HinfI repeat have been found, one (A + B) with an additional HinfI site. These two sequences (A + B and C) are the most frequent versions of the basic repeat of mustard satellite DNA. The basic 172 bp unit does not contain subrepeats or palindromic sequences. It is not similar (at a criterion of 15 common bases) with any known satellite sequence. It is not unusually highly methylated in the native state.     

Characterization of histones and chromatin of the hepatopancreas in Palaemon serratus (Crustacea Natantia)]

The chromatin of shrimp hepatopancreas has been extracted from isolated nuclei and characterized. Nuclei were prepared in the presence of Cu++ and phenyl methyl sulfonyl fluoride in order to inhibit the nuclease and protease activities throughout the different purification steps. The purified nuclei are heterogenous in size and show a density of 1,367 g/ml determined on saccharose - glucose gradients. After washing in 0,14 M NaCl and then in 10(-2) M Tris-HCL, pH = 7,6, the nuclei were disrupted in water. The solubilized chromatin was precipitated in 0,15 M.NaCl. This chromatin is characterized by a high level of RNA (RNA/DNA = 0,38) and of non histone proteins (NHP/DNA = 0,6). The denaturation curve showed only one Tm at 69 degrees in 2.10(-4) M.EDTA. When the chromatin was extracted in the presence of staphylococcal nuclease, the Tm reached 80 degrees C. The kinetics of the digestion by the staphylococcal nuclease have been studied and show that 10 per cent of hydrolysis occurs within the first minute. The repeat length of DNA as determined with the polymers of higher order is 189 +/- 5 base pairs. The existence of nucleosomes was confirmed by electron microscopy. The superstructure of chromatin was not completely destroyed after solubilisation with a Potter. The histones were studied by gel electrophoresis after differential staining. The most important feature consists in the presence of two H1, two H2A and two H4. The acetylation levels of the histones were followed after injection of 14C-acetate in vivo. The subfraction H1, 0 was acetylated. Only one H3 was present and the two H2A fractions showed the same level of acetylation. H2B migrated faster than the H2A fractions like in Echinoderms. The two H4 fractions corresponded to two differently acetylated forms. Shrimp hepatopancreas histones were fractionated by molecular sieving on Biogel P 100 and characterized according to their electrophoretic properties as well as their amino-acid content. The amino-acid compositions of the different histone fractions were nearer to Echinoderm and Sipunculid histones, than Calf thymus homologue histones. All the fractions show a weaker basicity. The H3 fraction was the only one showing a lesser variability when compared to Calf thymus H3. The non histone proteins were extracted in 10(-2) M Tris-HCL, pH = 8 and 0.1 per cent SDS. A series of 50 proteins was detected. 80 per cent of the total amount of protein was localized in a molecular weight range comprised between 40 000 and 80 000 daltons. These proteins were compared to the histones and total proteins of sonicated chromatin solubilized by SDS in order to detect proteasic effects.     

Reiteration frequency of procollagen genes in the guinea pig genome: Collagen genes are not amplified during granuloma fibroblasts differentiation

Procollagen mRNA was purified from collagen synthesizing polysomes obtained from an experimental guinea pig granuloma, and iodinated in vitro. The procollagen ¹²⁵I-labelled mRNA was hibridized with granuloma and liver guinea pig DNA in vast DNA excess conditions. A Cot $\text{1}\text{2}$ 800–900 mol · s · l^?1 for both tissues was obtained from the hybridization curves. With these results, we could suggest the existence of 11–13 procollagen genes per haploid genome. By the analysis of the hybridization data it was possible to infer that there is no genomic amplification in tissues highly specialized in the synthesis of collagen such as granuloma.     

Bacterial citrate lyase

Bacterial citrate lyase, the key enzyme in fermentation of citrate, has interesting structural features. The enzyme is a complex assembled from three non-identical subunits, two having distinct enzymatic activities and one functioning as an acyl-carrier protein. Bacterial citrate lyase,si-citrate synthase and ATP-citrate lyase have similar stereospecificities and show cofactor cross-reactions. On account of these common features, the citrate enzymes are promising markers in the study of evolutionary biology. The occurrence, function, regulation and structure of bacterial citrate lyase are reviewed in this article.     

The binding of 7,12-dimethylbenz(a)anthracene to replicating and non-replicating DNA in mouse skin

The extent of in vitro binding of 7,12-dimethylbenz(a)anthracene (DMBA) to replicating and non-replicating DNA of mouse skin epidermis was studied. Mice which were pretreated topically with croton oil in order to stimulate DNA synthesis were treated in the same area of the back with DMBA at zero time. In addition, 5-bromodeoxyuridine (BUdR) and 5-fluorouracil (5-FU) were injected at zero time and subsequently every half hour for 7.5 h. At 8 h the mice were killed and epidermal DNA was subjected to an isopycnic cesium chloride density gradient. Binding was found to both replicating and non-replicating DNA but was reproducibly greater to non-replicating DNA. BUdR substitution into replicating DNA was shown not to be a cause of reduced binding of DMBA.     

Cytotoxicity and mutagenicity of aflatoxin dichloride in normal and repair deficient diploid human fibroblasts

The cytotoxic and mutagenic effect of aflatoxin B1-dichloride (AFB1-Cl2), a direct-acting carcinogen which is a model for the proposed ultimate reactive metabolite of AFB1 (the 2,3-epoxide), was compared in normal, repair-proficient, diploid human fibroblasts and in complementation Group A xeroderma pigmentosum cells (XP12BE) which are virtually incapable of excision repair of DNA damage induced by ultraviolet radiation, the 7,8-diol-9,10-epoxide of benzo[alpha]pyrene, and several reactive aromatic amide derivatives. The XP cells were significantly more sensitive than normal to the cytotoxic and mutagenic effects of AFB1-Cl2, not only as a function of concentration administered but also of the number of AFB1-Cl2 residues initially bound to DNA. Cytotoxicity was determined from survival of colony-forming ability; resistance to 6-thioguanine was the genetic marker used for mutagenicity. We compared the rate of loss of AFB1-Cl2-DNA adducts from cells treated and held in the non-dividing state (confluent) over several days, as well as their ability to recover from the potentially mutagenic and/or cytotoxic effects of the agent. AFB1-Cl2 residues were lost from both strains of cells and both exhibited a gradual increase in survival. However, the rate of loss of adducts from the DNA in the normal cells was more rapid than in XP cells and they exhibited recovery from higher doses of AFB1-Cl2 than XP cells. The major primary DNA adduct formed in the human cells and in isolated DNA was a chemically unstable guanine derivative which could undergo a change in structure with time posttreatment to form a more stable secondary adduct. The cytotoxic effect of AFB1-Cl2 was highly correlated with the presence of either of these guanine adducts. Evidence suggests that the primary adduct is an N7-guanine adduct. The kinetics of the loss of this guanine and its transformation into the more stable secondary adduct resembled that reported recently for the major primary DNA adduct formed by the reaction of AFB1 at the N-7 position of guanine in the DNA of normal and XP cells and its transformation into the putative AFB1-ring opened triamino pyrimidyl structure.     

Lack of mutagenicity of vinyl chloride in two strains of Neurospora crassa.

No detectable induction of mutations could be found in two strains of Neurospora crassa after their conidia were treated with vinyl chloride, in ethanol solution and in its gaseous form. The results suggest that although N. crassa seems to lativating systems does not increase mutagenic activity of vinyl chloride in the two strains tested. At the same time these strains were mutated easily by UV and methyl methanesulfonate.     

Analysis of a polymorphic region of the Euglena gracilis chloroplast genome

The circular chloroplast genome of Euglena gracilis is known to carry a single region of variable length (polymorphic region) located on BglII·Z fragments (6.1–6.9 kbp). We now have cloned a BglII·Z fragment (6.35 kbp) using as vector a modified pBR322. The cloned BglIl·Z fragment is split by HindIII into fragments of 1.0, 2.6 and 2.75 kbp and by HaeIII into fragments of 0.05, 1.35 and 4.95 kbp, respectively. The zone of variable length on this BglIl·Z fragment can be confined to a BglII-HindIII fragment of 2.6 kbp which is next to the previously mapped BglIl·G₁ (4.7 kbp) and about 4.5 kbp away from the 5′ end of the ‘extra’ 16 S rRNA gene. Two HindIII fragments from the polymorphic region of 5.9 and 6.1 kbp, respectively, were cloned and used in electron microscopic studies. Heteroduplexes formed between the two cloned HindIII fragments show the expected size difference of about 200 bp. Single strand reannealing experiments allow us to place the polymorphic region between two previously mapped short inverted repeats and partial DNA melting experiments indicate that the polymorphic region is very rich in dA-dT.