In vitro construction of bacteriophage λ and plasmid DNA molecules containing DNA fragments from bacteriophage T4

Restriction endonucleases EcoRI and HindIII generated fragments of T4 cytosine-containing DNA were inserted into bacteriophage vector λgtSu_III and plasmid vectors pMB9 and pBR313. Resulting clones were screened for hybridization with ³²P labeled T4 tRNA. Recombinant bacteriophages and plasmids were isolated which contained a T4 fragment coding for T4 RNA species 1 and 2 and T4 tRNA^Arg. Selected λ-T4 hybrid bacteriophages were grown to high titer and their DNA analyzed by gel electrophoresis.     

Cloning of the yeast tyrosine transfer RNA genes in bacteriophage lambda.

Lambda bacteriophage containing yeast tyrosine transfer RNA genes were prepared by molecular recombination. These phage were identified by hybridization of ¹²⁵I-labeled yeast tRNA^Tyr to plaques from lambda-yeast recombinant phage pools. The cloned yeast EcoRI fragments that hybridize to ¹²⁵I-labeled tRNA^Tyr were compared in size with the fragments in total yeast DNA that hybridize to the same probe. These comparisons indicate that seven of the eight different tRNA^Tyr genes have been isolated. Unambiguous evidence that these seven fragments contain tRNA^Tyr coding regions was obtained by showing that they hybridize to aminoacylated [^3H]Tyr-tRNA^Tyr. Only one of the fragments hybridizes to ³²P-labeled total yeast tRNA in the presence of competing unlabeled tRNA^Tyr; the tRNA^Tyr genes, therefore, are not predominantly organized into heteroclusters of tRNA genes.     

Processing of bacteriophage T4 tRNAs. The role of RNAase III

In order to assess the contribution of the processing enzyme RNAase III to the maturation of bacteriophage T4 transfer RNA, RNAase III⁺ and RNAase III^? strains were infected with T4 and the tRNAs produced were analyzed. Infection of the RNAase III⁺ strains of Escherichia coli with T4Δ27, a deletion strain missing seven of the ten genes in the T4 tRNA cluster, results in the appearance of a transient 10.1 S RNA molecule as well as the three stable RNAs encoded by T4Δ27, species 1, rRNA^Leu and tRNA^Gln. Infection of an RNAase III^? strain results in the appearance of a larger, transient RNA molecule, 10.5 S, and a severe reduction in the accumulation of tRNA^Gln. The 10.5 S RNA is similar to 10.1 S RNA but contains extra nucleotides (about 50) at the 5′ end. (10.1 S contains all the three final molecules plus about 70 extra nucleotides at the 3′ end.) Both 10.5 S and 10.1 S RNAs can be processed in vitro into the three final molecules. When 10.1 S is the substrate, the three final molecules are obtained whether extracts of RNAase III⁺ or RNAase III^? cells are used. However, when 10.5 S is the substrate RNAase III⁺ extracts bring out normal maturation, while using RNAase III^? extracts the level of tRNA^Gln is severely reduced. When 10.5 S is used with RNAase III⁺ extracts maturation proceeds via 10.1 S RNA, while when RNAase III^? extracts were used 10.1 S is not detected. The 10.5 S RNA can be converted to 10.1 S RNA by RNAase III in a reaction which produces only two fragments. The sequence at the 5′ end of the 10.5 S suggests a secondary structure in which the RNAase III cleavage site is in a stem. These experiments show that the endonucleolytic RNA processing enzyme RNAase III is required for processing at the 5′ end of the T4 tRNA cluster where it introduces a cleavage six nucleotides proximal to the first tRNA, tRNA^Gln, in the cluster.     

Specific binding of bovine immunoglobulins to Sepharose and Sephadex

Bacteriophage T5 BglII/HindIII DNA fragment (803 basepairs), containing the genes for 2 tRNAs and 2 RNAs with unknown functions, was cloned in the plasmid pBR322. The analysis of DNA sequence indicates that tRNA genes code isoacceptor tRNAs^Ser (tRNA^Ser₁ and tRNA^Ser₂) with anticodons UGA and GGA, respectively. The main unusual structural feature of these tRNAs is the presence of extra non-basepaired nucleotides in the joinings of stem ‘b’ with stems ‘a’ and ‘c’.     

Construction and properties of recombinant plasmids containing the rII genes of bacteriophage T4.

Summary The EcoRI digestion products of phage T4 DNA have been examined using a phage DNA transformation assay. A 2.6x10⁶ Dalton fragment was found to contain the rII genes. This fragment was purified and then treated with HindIII endonuclease. The cleavage products were ligated to the vector plasmid pBR313 and viable recombinant plasmids recovered. A genetic assay was employed to demonstrate that the recombinants contained T4 DNA and to localize on the phage genetic map the EcoRI and HindIII sites cleaved during the construction of the plasmids. Preliminary characterization suggests that a fragment covering the beginning of the rIIA gene possibly contains a promotor which is active in uninfected cells.Abbreviations used Ap ampicillin - Tc tetracycline - Mdal 10⁶ Daltons - bp base pairs     

Organization and expression of a two-gene cluster in the arginine biosynthesis of Saccharomyces cerevisiae.

Summary Using the pMB9 recombinant plasmid pMY3, which contains a functional gene for the tRNA^Try mutant Su⁺7, the EcoRI fragment containing the tRNA^Try gene is mapped and oriented with respect to the HindIII site in the tetracycline region of pMB9. Complete HpaII and HaeIII maps of the EcoRI fragment are derived. The Su⁺7 tRNA gene is placed by hybridization to these fragments, and the tRNA gene is oriented by using the restriction sites for HinfI, TaqI, and HpaII in the tRNA gene itself. A tRNA^Asp gene is shown to lie adjacent to tRNA^Try, and is also placed and oriented in the map. The RI fragment itself originates in a locus adjacent to, and transcribed in the same direction as, the ribosomal RNA genes of 80d₃.The implications of the structure of the cloned DNA for its previously measured regulatory and tRNA gene activities are discussed. In particular, the effect on the regulation of RNA synthesis is attributable to an E. coli DNA sequence, but cannot be due to the presence of a normal tRNA promoter on the plasmid.Abbreviations MD megadaltons; expressions of the form HpaII:0.075 refer to a fragment generated by the indicated restriction nuclease, having the indicated molecular weight, in MD     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

Identification of transfer RNA suppressors in Escherichia coli. II. Duplicate genes for tRNA2Gln.

The number of gene copies for tRNA₂^Gln in λpsu⁺2 was determined by genetic and biochemical studies. The transducing phage stimulates the production of the su⁺2 (amber suppressor) and su°2 glutamine tRNAs and methionine tRNA_m. When the su⁺2 amber suppressor was converted to an ochre suppressor by single-base mutation, the phage stimulated ochre-suppressing tRNA₂^Gln, instead of the amber-suppressing tRNA₂^Gln. From the transducing phage carrying the ochre-suppressing allele, strains carrying both ochre and amber suppressors were readily obtainable. These phages stimulated both ochre-suppressing and amber-suppressing tRNA₂^Gln, but not the non-suppressing form. We conclude that the original transducing phage carries two tRNA₂^Gln genes, one su⁺2 and one su°2. The transducing phage carrying two suppressors, ochre and amber, segregates one-gene derivatives that encode only one or the other type of suppressor tRNA. These derivatives apparently arise by unequal recombination involving the two glutamine tRNA genes in the parental phage. This segregation is not accompanied by the loss of the tRNA_m^Met gene. Based on these results, it is suggested that Escherichia coli normally carries in tandem two identical genes specifying tRNA₂^Gln at 15 minutes on the bacterial chromosome. su⁺2 mutants may arise by single-base mutations in the anticodon region of either of these two, leaving the other intact. By double mutations, tRNA₂^Gln genes could also become ochre suppressors. A tRNA_m^Met gene is located near, but not between, these two tRNA₂^Gln genes.     

Isolation and some properties of DNA coding for tRNA1met from Xenopus laevis

DNA containing the reiterated genes for tRNA₁^met has been partially purified from Xenopus laevis by centrifugation in actinomycin C₁-CsCl and Ag⁺-Cs₂SO₄ gradients. These gradients separate the tRNA₁^met genes from those coding for tRNA₂^met and tRNA^val, thus confirming our earlier suggestion that these genes are not intermingled with each other (Clarkson, Birnstiel, and Purdom, 1973). The gradients also demonstrate the existence of a minor 5S DNA fraction which appears to differ from that previously isolated by Brown, Wensink, and Jordan (1971).When the enriched tDNA₁^met is digested to completion with either of the restriction endonucleases EcoRI or Hpa I, the tRNA₁^met genes are predominantly found within DNA fragments that are about 3100 base pairs long. A partial digestion with EcoRI shows that these fragments arise from the regular spacing of the enzyme restriction sites. The 3100 base pair EcoRI fragments are cleaved by Hpa I into fragments of two size classes, one of which is about 2200 base pairs long and contains the tRNA₁^met genes. The shorter fragments are about 700 base pairs long, and they appear to contain genes coding for at least one other kind of tRNA species. X. laevis tDNA₁^met thus comprises tandemly repeated DNA whose component parts show little if any length heterogeneity.     

Biochemical Studies on Bovine Adenovirus Type 3 IV. Transformation by Viral DNA and DNA Fragments

By the calcium technique, intact DNA of bovine adenovirus type 3 (BAV3) was found to transform A31 cells, a clone of BALB/3T3. Transforming activity was resistant to RNase and Pronase but sensitive to DNase. The efficiency of transformation was approximately 5 to 10 foci per μg of DNA. Attempts were also made to test for transforming activity of BAV3 DNA fragments prepared with restriction endonucleases EcoRI and HindIII. The activity was found to associate exclusively with the EcoRI D fragment mapped in the region of 3.6 and 19.7 units (molecular weight, 3.9 × 10⁶). No transformation could be obtained with three HindIII fragments, J, E, and B, located at the left-hand end of the BAV3 genome. However, the enzymatic joining of J and E fragments (0 to 11.9 map units) with a ligase restored the transforming activity. These results suggest that all the genetic information of BAV3 required for transformation is located in the region between 3.6 and 11.9 units on the viral genome. Some properties of A31 cells transformed by BAV3 DNA EcoRI D fragment (TrD) and the ligated DNA of HindIII J and E fragments (TrJE), as well as those transformed by whole BAV3 DNA (Tr), were examined. As compared to untransformed A31 cells, all the transformed cell lines tested showed rapid growth, high saturation densities, and anchorage-independent growth. Moreover, they contained BAV3-specific T antigen and induced tumors in adult nude and BALB/c mice. These properties of Tr, TrD, and TrJE lines were similar to those of BAV3-transformed cells.     

Analysis of genomic tRNA revealed presence of novel genomic features in cyanobacterial tRNA

Transfer RNAs (tRNA) are important molecules that involved in protein translation machinery and acts as a bridge between the ribosome and codon of the mRNA. The study of tRNA is evolving considerably in the fields of bacteria, plants, and animals. However, detailed genomic study of the cyanobacterial tRNA is lacking. Therefore, we conducted a study of cyanobacterial tRNA from 61 species. Analysis revealed that; cyanobacteria contain thirty-six to seventy-eight tRNA gens per genome that encodes for 20 tRNA isotypes. The number of iso-acceptors (anti-codons) ranged from thirty-two to forty-three per genome. tRNA^Ile with anti-codon AAU, GAU, and UAU was reported to be absent from the genome of Gleocapsa PCC 73,106 and Xenococcus sp. PCC 7305. Instead, they were contained anti-codon CAU that is common to tRNA^Met and tRNA^Ile as well. The iso-acceptors ACA (tRNA^Cys), ACC (tRNA^Gly), AGA, ACU (tRNA^Ser), AAA (tRNA^Phe), AGG (tRNA^Pro), AAC (tRNA^Val), GCG (tRNA^Arg), AUG (tRNA^His), and AUC (tRNA^Asp) were absent from the genome of cyanobacterial lineages studied so far. A few of the cyanobacterial species encode suppressor tRNAs, whereas none of the species were found to encode a selenocysteine iso-acceptor. Cyanobacterial species encode a few putative novel tRNAs whose functions are yet to be elucidated.     

Molecular cloning of the T4 genome; organization and expression of the frd--DNA ligase region

Summary derivatives including the thymidylate synthetase (td) gene of T4 were selected by their ability to substitute for the thyA gene of E. coli. Two HindIII fragments of T4 DNA, but only one EcoRI fragment, are required for a functional td gene; one of the HindIII fragments includes a functional frd gene. The organisation of the EcoRI and HindIII fragments in the td region and their orientation with respect to the T4 genome have been deduced from genetic, physical, and functional evidence. The T4 genes can be transcribed from phage promoters and the T4td derivatives include genes specifying five T4 polypeptides. Three of these are identified as the products of the frd, td, and nrdA genes; two, neither of which appears to be the nrdB gene product, remain to be identified. Some td phages yield lysogens of thyA bacteria which are thymine-independent and some frd phages yield trimethoprim-resistant lysogens, indicating that the td and frd genes can be transcribed from included T4 DNA sequences. EcoRI fragments of DNA from the td and lig regions, used as probes, identified a single large HindIII fragment that joins the HindIII fragment carrying the DNA ligase gene to that carrying the td gene. Since this fragment, which must include genes coding for RNA ligase and polynucleotide kinase, could not be recovered in either phage or plasmid vectors, a derivative of it was used to identify the EcoRI fragments located between the td and DNA ligase genes. The order of these fragments within the T4 genome was deduced and all but one of them cloned in a vector. As none of these recombinants rescued T4 phage having mutations within the RNA ligase gene, the missing fragment may include this gene. Three adjacent EcoRI fragments, each of which has been cloned, are missing in a mutant of T4 deleted for the polynucleotide kinase gene.     

A role for ribonuclease III in synthesis of bacteriophage T4 transfer RNAs.

Synthesis of T4 tRNA^Gln depends on normal levels of $\text{Escherichia}\text{coli}$ ribonuclease III. Infection of cell strains carrying a mutation in the gene for this enzyme resulted in severe depression in tRNA^Gln production, as revealed by chemical and suppressor tRNA analyses. The remaining seven T4 tRNAs were synthesized in the mutant cells. The requirement of ribonuclease III for synthesis of tRNA^Gln points to an essential cleavage by the enzyme of a precursor RNA containing tRNA^Gln.     

The structure of the phi 80d3 ilv+ Su+7 transducing phage and the origin of its Su+7 tRNA-gene containing fragment.

Summary The Bam HI, XhoI, and EcoRI sites of the transducing phage 80d₃Su⁺ 7ilv⁺ are located. The 1.2×10⁶ MD EcoRI fragment which, when cloned, contains tRNA^Asp and expresses the mutant tRNA^Try gene, Su⁺7, and which also relaxes control of stable RNA synthesis is found immediately adjacent to the rrnC region. Its tRNA genes, tRNA^Asp and tRNA^Try, are transcribed in the same direction as the ribosomal RNA genes, though no mature rRNA sequences are on the fragment. This fragment also exists as such in another F-prime factor derived from the same Hfr host, and therefore presumably also in the Hfr chromosome itself. It is composed of about half ordinary chromosomal and half F DNA sequences, the latter from the - region of F.The advantages of a novel mapping method used are discussed.Abbreviations MD megadaltons. Expressions of the form XhoI: 5.5 refers to a DNA fragment produced by the indicated enzyme, and characterized by the indicated molecular weight in MD     

The localization of tRNA 5 Asn,tRNAHis, and tRNAAla genes from Drosophila melanogaster by in situ hybridization to polytene salivary gland chromosomes

Transfer RNA _5; ^Asn , tRNA _; ^His , and tRNA^Ala were isolated from Drosophila melanogaster by means of Sepharose 4B chromatography and 2-dimensional polyacrylamide gel electrophoresis. The tRNAs were iodinated in vitro with Na¹²⁵I and hybridized in situ to salivary gland chromosomes from Drosophila. Subsequent autoradiography allowed the localization of the genes for tRNA _5; ^Asn in the regions 42A, 59F, 60C, and 84F; for tRNA^His in the regions 48F and 56E; and for tRNA^Ala in the regions 63A and 90C. From these and our previous results it can be concluded that the genes for the Q-base containing tRNAs (tRNA^Asn, tRNA^Asp, and tRNA^His, are not clustered in the Drosophila melanogaster genome.     

Molecular cloning and mapping of a deletion derivative of the plasmid Rts 1

The plasmid pTW20 is a deletion derivative of the kanamycin resistance plasmid Rts1. By digesting pTW20 DNA with EcoRI endonuclease six fragments were generated, and each was cloned in the vector plasmid pACYC184. These cloned EcoRI fragments were further digested with various endonucleases, and the cleavage map of pTW20 was constructed. A SalI fragment (1.5 Md) in E1 (the largest EcoRI fragment; 11.5 Md) contained the genes kan (kanamycin resistance) and puv (uv sensitization of host). An electron microscopy study of a BamHI fragment containing kan revealed the presence of a transposon-like structure in the fragment. The smallest EcoRI fragment E6 (2.0 Md) was capable of autonomous replication in a polA host, indicating that E6 contained replication genes of pTW20. These genes were found to be located on a 1.1-Md HindIII fragment in E6. Two incompatibility genes were identified on the pTW20 genome, one located on each of the fragments E6 and E5 (3.5 Md), and expressed T incompatibility independently. The nature of the temperature sensitivity of pTW20 was discussed.