共查询到20条相似文献,搜索用时 93 毫秒
1.
Merdan T Kunath K Petersen H Bakowsky U Voigt KH Kopecek J Kissel T 《Bioconjugate chemistry》2005,16(4):785-792
The influence of PEGylation on polyplex stability from poly(ethylene imine), PEI, and plasmid DNA was investigated both in vitro and after intravenous administration in mice. Polyplexes were characterized with respect to particle size (dynamic light scattering), zeta-potential (laser Doppler anemometry), and morphology (atomic force microscopy). Pharmacokinetics and organ accumulation of both polymers and pDNA were investigated using 125I and 32P radioactive labels, respectively. Furthermore gene expression patterns after 48 h were measured in mice. To elucidate the effect of different doses, all experiments were performed using ca. 1.5 microg and 25 microg of pDNA per mouse. Our studies demonstrated that both PEI and PEG-PEI form stable polyplexes with DNA with similar sizes of 100-130 nm. The zeta potential of PEI/pDNA polyplexes was highly positive, whereas PEG-PEI/pDNA showed a neutral surface charge as expected. The pharmacokinetic and organ distribution profiles after 2 h show similarities for both PEI and pDNA blood-level time curves from polyplexes at both doses indicative for significant stability in the bloodstream. A very rapid clearance from the bloodstream was observed and as major organs of accumulation liver and spleen were identified. PEG-PEI/pDNA complexes at a dose of approximately 25 microg exhibit similar profiles except a significantly lower deposition in the lung. At the lower dose of approximately 1.5 microg pDNA, however, for polyplexes from PEG-PEI, significant differences in blood level curves and organ accumulation of polymer and pDNA were found. In this case PEG-PEI shows a greatly enhanced circulation time in the bloodstream. By contrast, pDNA was rapidly cleared from circulation and significant amounts of radioactivity were found in the urine, suggesting a rapid degradation possibly by serum nucleases after complex separation. Regarding in vivo gene expression, no luciferase expression could be detected at approximately 1.5 microg dose in any organ using both types of complexes. At 25 microg only in the case of PEI/pDNA complexes were significant levels of the reporter gene detected in lung, liver, and spleen. This coincided with high initial accumulation of pDNA complexed with PEI and a high acute in vivo toxicity. For PEG-PEI, initial accumulation was much lower and no gene expression as well as a low acute toxicity was found. In summary, our data demonstrate that PEG-PEI used in this study is not suitable for low dose gene delivery. At a higher dose of approximately 25 microg, however, polyplex stability is similar to PEI/pDNA combined with a more favorable organ deposition and significantly lower acute in vivo toxicity. These findings have consequences for the design of PEG-PEI-based gene delivery systems for in vivo application. 相似文献
2.
Two different series of polyethylenimine (PEI) block copolymers grafted with linear poly(ethylene glycol) (PEG) were investigated as delivery systems for oligodeoxynucleotides (ODN) and ribozymes. The resulting interpolyelectrolyte complexes were characterized with respect to their physicochemical properties, protection efficiency against enzymatic degradation, complement activation, and biological activity under in vitro conditions. The effect of PEG molecular weight and the graft density of PEG blocks on complex characteristics was studied with two different series of block copolymers. The resulting ODN complexes were characterized by photon correlation spectroscopy (PCS) and laser Doppler anemometry (LDA) to determine complex size and zeta potential. Electrophoresis was performed to study the protective effects of the different block copolymers against enzymatic degradation of ODN. Intact ODN was quantified via densitometric analysis. Ribozymes, a particularly unstable type of oligonucleotides, were used to examine the influence of block copolymer structure on biological activity. The stabilization of ribozymes was also characterized in a cell culture model. Within the first series of block copolymers, the grafted PEG chains (5 kDa) had marginal influence on the complex size. Two grafted PEG chains were sufficient to achieve a neutral zeta potential. Within the second series, size and zeta potential increased with an increasing number of PEG chains. A high number of short PEG chains resulted in a decrease in complex size to values comparable to that of the homopolymer PEI 25 kDa and a neutral zeta potential, indicating a complete shielding of the charges. Complement activation decreased with an increasing number of short PEG 550 Da chains. Ribozyme complexes with PEG-PEI block copolymers achieved a 50% down-regulation of the target mRNA. This effect demonstrated an efficient stabilization and biological activity of the ribozyme, which was comparable to that of PEI 25 kDa. PEGylated PEI block copolymers represent a promising new class of drug delivery systems for ODN and ribozymes with increased biocompatibility and physical stability. 相似文献
3.
To advance knowledge on polyplex structure and composition, fluorescence resonance energy transfer (FRET) and anisotropy measurements were applied to polyplexes of rhodamine-labeled polyethylenimine (PEI) and fluorescein-labeled double-stranded oligodeoxynucleotide (ODN). About 25?kDa PEI was compared with low-molecular-weight PEI of 2.7?kDa. FRET reached maxima at amine to phosphate (N/P) ratios of 2 and 3 for 2.7?kDa and 25?kDa PEI, respectively, with similar average distances between donor and acceptor dye molecules in polyplexes. Anisotropy measurements allowed estimating the bound fractions of PEI and ODN. At N/P?=?6, all ODN was bound, but only 58% of PEI 25?kDa and 45% of PEI 2.7?kDa. In conclusion, the higher molecular weight of PEI may conformationally restrict the availability of amino groups for charge interaction with phosphate groups in ODN. Moreover, significant fractions of both types of PEI remain free in solution at N/P ratios frequently used for transfection. FRET and anisotropy measurements provide effective tools for probing polyplex compositions and designing optimized delivery systems. 相似文献
4.
Inefficient delivery of antisense oligonucleotides (AOs) to target cell nuclei remains as the foremost limitation to their usefulness. Copolymers of cationic poly(ethylene imine) (PEI) and poly(ethylene glycol) (PEG) have been well-studied for delivery of plasmids. However, the properties of PEG-PEI-AO polyplexes have not been comprehensively investigated. Therefore, we synthesized a series of PEG-PEI copolymers and evaluated their physiochemical properties alone and when complexed with AO. The M(w) of PEG was found to be the main determinant of polyplex size, via its influence on particle aggregation. DLS measurements showed that when PEG5000 was grafted to PEI2K and PEI25K, polyplex diameters were extremely small (range 10-90 nm) with minimal aggregation. In contrast, when PEG550 was grafted to PEI2K and PEI25K, polyplexes appeared as much larger aggregates (approximately 250 nm). As expected, the surface charge (zeta potential) was higher for polyplexes containing PEI25K than those containing PEI2K, but decreased with increased levels of PEG grafting. Surprisingly, within the physiological range (pH 7.5-5), the buffering capacity of all copolymers was nearly equivalent to that of unsubstituted PEI2K or PEI25K, and was barely influenced by PEGylation. The stability of polyplexes was evaluated using a heparin polyanion competition assay. Unexpectedly, polyplexes containing PEI2K showed stability equal to or greater than that of PEI25K polyplexes. The level of PEG grafting also had a dramatic effect on polyplex stability. The relationships established between molecular formulations and polyplex size, aggregation, surface charge, and stability should provide a useful guide for future studies aimed at optimizing polymer-mediated AO delivery in cell and animal studies. A summary of the relationships between polyplex structures and recent studies of their transfection capacity is provided. 相似文献
5.
Shi F Visser WH de Jong NM Liem RS Ronken E Hoekstra D 《Experimental cell research》2003,291(2):313-325
Successful application of antisense oligonucleotides (ODNs) in cell biology and therapy will depend on the ease of design, efficiency of (intra)cellular delivery, ODN stability, and target specificity. Equally essential is a detailed understanding of the mechanism of antisense action. To address these issues, we employed phosphorothioate ODNs directed against specific regions of the mRNA of the serotonin 5HT1A receptor, governed by sequence and structure. We demonstrate that rather than various intracellular factors, the gene sequence per se primarily determines the antisense effect, since 5HT1a autoreceptors expressed in RN46A cells, postsynaptic receptors expressed in SN48 cells, and receptors overexpressed in LLP-K1 cells are all efficiently downregulated following ODN delivery via a cationic lipid delivery system. The data also reveal that the delivery system as such is a relevant parameter in ODN delivery. Antisense ODNs bound extensively to the RNA matrix in the cell nuclei, thereby interacting with target mRNA and causing its subsequent degradation. Antisense delivery effectively diminished the mRNA pool, thus resulting in downregulation of newly synthesized 5HT1A proteins, without the appearance of truncated protein fragments. In conjunction with the selected mRNA target sequences of the ODNs, the latter data indicated that effective degradation rather than a steric blockage of the mRNA impedes protein expression. The specificity of the antisense approach, as described in this study, is reflected by the effective functional downregulation of the 5-HT1A receptor. 相似文献
6.
The delivery of oligodeoxynucleotides (ODNs) into cells is widely utilized for antisense, antigene, aptamer, and similar approaches to regulate gene and protein activities based upon the ODNs' sequence-specific recognition. Short pieces of DNA can also be generated in biological processes, for example, after degradation of viral or bacterial DNA. However, the mechanisms that regulate intracellular trafficking and localization of ODNs are not fully understood. Here we study the effects of major transporters of microRNA, exportin-1 (Exp1) and exportin-5 (Exp5), on the transport of single-stranded ODNs in and out of the nucleus. For this, we employed a fluorescent microscopy-based assay to quantitatively measure the redistribution of ODNs between the nucleus and cytoplasm of live cells. By measuring the fluorescent signal of the nuclei we observed that after delivery into cells via cationic liposomes ODNs rapidly accumulated inside nuclei. However, after removal of the ODN/liposome containing media, we found re-localization of ODNs from the nuclei to cytoplasm of the cells over the time course of several hours. Downregulation of the Exp5 gene by siRNA resulted in a slight increase of ODN uptake into the nucleus, but the kinetics of ODN efflux to the cytoplasm was not affected. Inhibition of Exp1 with leptomycin B somewhat slowed down the clearance of ODNs from the nucleus; however, within 6 hours most of the ODN were still being cleared form the nucleus. ODNs that could form intramolecular G-quadruplex structures behaved differently. They also accumulated in nuclei, although at a lesser extent than unstructured ODN, but they remained there for up to 20 hours after transfection, causing significant cell death. We conclude that Exp1 and Exp5 are not the major transporters of our ODNs out of the nucleus, and that the transport of ODNs is strongly affected by their secondary structure. 相似文献
7.
The use of antisense oligodeoxynucleotides (ODNs) to inhibit the expression of specific mRNA targets represents a powerful technology for control of gene expression. Cationic lipids and polymers are frequently used to improve the delivery of ODNs to cells, but the resulting complexes often aggregate, bind to serum components, and are trafficked poorly within cells. We show that the addition of a synthetic, pH-sensitive, membrane-disrupting polyanion, poly(propylacrylic acid) (PPAA), improves the in vitro efficiency of the cationic lipid, DOTAP, with regard to oligonucleotide delivery and antisense activity. In characterization studies, ODN complexation with DOTAP/ODN was maintained even when substantial amounts of PPAA were added. The formulation also exhibited partial protection of phosphodiester oligonucleotides against enzymatic digestion. In Chinese hamster ovary (CHO) cells, incorporation of PPAA in DOTAP/ODN complexes improved 2- to 3-fold the cellular uptake of fluorescently tagged oligonucleotides. DOTAP/ODN complexes containing PPAA also maintained high levels of uptake into cells upon exposure to serum. Addition of PPAA to DOTAP/ODN complexes enhanced the antisense activity (using GFP as the target) over a range of PPAA concentrations in both serum-free, and to a lesser extent, serum-containing media. Thus, PPAA is a useful adjunct that improves the lipid-mediated delivery of oligonucleotides. 相似文献
8.
9.
Yun Wu Zhengzheng Fei L. James Lee Barbara E. Wyslouzil 《Biotechnology and bioengineering》2010,105(4):834-841
DNA/polyethylenimine (PEI) polyplexes are an important class of nonviral vectors. Although the conventional preparation method, bulk mixing, is straightforward, the formation of the DNA/PEI polyplexes is not well controlled. This work explores coaxial electrohydrodynamic spraying (EHDS) as a novel, alternative method to produce DNA/PEI polyplexes in a more controlled manner. Both pGFP/PEI and pSEAP/PEI polyplexes were produced by EHDS with a coaxial needle setup. The size of the polyplexes was determined using dynamic light scattering, and their ability to transfect NIH 3T3 cells was observed by using an inverted fluorescence microscope (pGFP) or quantified by measuring the activity level of alkaline phosphatase (pSEAP). At nitrogen to phosphate ratio (N/P) of 6.7, the polyplexes produced by coaxial EHDS had delivery efficiencies up to 2.6 times higher than those produced by bulk mixing. The N/P ratio and the structure of the EHDS used to make the polyplexes were crucial factors in determining the delivery efficiency. Biotechnol. Bioeng. 2010. 105: 834–841. © 2009 Wiley Periodicals, Inc. 相似文献
10.
BACKGROUND: Interleukin-4 (IL-4) plays a crucial role as an inflammatory mediator in allergic asthma via inducing Th2 inflammation and IgE synthesis. To develop an effective therapeutic agent which specifically inhibits production of IL-4, antisense oligodeoxynucleotides (AS-ODNs) against murine IL-4 mRNA were generated and complexed with polyethylenimine (PEI) to improve intracellular delivery. METHODS: AS-ODNs were generated against the translation initiation region of murine IL-4 mRNA, and complexed with linear PEI. In vitro efficacy of AS-ODNs/PEI complexes was tested by measuring IL-4 production in the D10.G4.1 cell line, and cytotoxicity was tested by XTT assay. Physicochemical properties of polyplexes were examined using atomic force microscopy (AFM) and DNase I protection assay. In vivo effects of IL-4 AS-ODNs/PEI complexes were tested in a murine model of airway inflammation. IL-4 concentrations in the bronchoalveolar lavage (BAL) fluid and circulating IgE levels were measured by ELISA, and histological analysis of lung tissues was performed. RESULTS: IL-4 AS-ODNs/PEI complexes were spheres with an average diameter of 98 nm and resistant to DNase I-mediated degradation. IL-4 AS-ODNs/PEI complexes showed up to 35% inhibition of IL-4 production in D10.G4.1 cells without causing any toxicity, while naked ODNs gave less than 1% reduction. Furthermore, IL-4 AS-ODNs/PEI complexes were effective in suppressing secretion of IL-4 (up to 30% reduction) in the BAL fluid in an ovalbumin-sensitized murine model of airway inflammation. Circulating IgE levels were decreased, and airway inflammation was alleviated by treatment with IL-4 AS-ODNs polyplexes. CONCLUSIONS: These data demonstrate that complexation of IL-4 AS-ODNs with PEI provides a potential therapeutic tool in controlling inflammation associated with allergic asthma, and further presents an opportunity to the development of clinical therapy based on combination of multiple AS-ODNs of cytokines and/or signaling effectors involved in Th2 inflammation and eosinophilia. 相似文献
11.
Zhao X Pan F Zhang Z Grant C Ma Y Armes SP Tang Y Lewis AL Waigh T Lu JR 《Biomacromolecules》2007,8(11):3493-3502
Although various cationic polymers have been used to condense anionically charged DNA to improve their transfection efficiency, there is still a lack of fundamental understanding about how to control the nanostructure and charge of the polyplexes formed and how to relate such information to cell transfection efficiency. In this work, we have synthesized a weak cationic and phosphorylcholine-containing diblock copolymer and used it as a model vector to deliver an antisense oligodeoxynucleotide (ODN) into HeLa cells. Small angle neutron scattering (SANS) was used to determine the copolymer/ODN polyplex structure. The SANS data revealed the formation of polyplex nanocylinders at high copolymer (N)/ODN (P) charge ratios, where N symbolizes the amine groups on the copolymer and P symbolizes the phosphate groups. However, the cylindrical lengths remained constant, indicating that the ODN binding over this region did not alter the cylindrical shape of the copolymer in solution. As the N/P ratio decreased and became close to unity the polyplex diameters remained constant, but their lengths increased substantially, suggesting the end-to-end bridging by ODN binding between copolymer cylinders. As the N/P ratios went below unity (with ODN in excess), the polyplex diameters increased substantially, indicating different ODN bridging to bundle the small polyplexes together. Transfection studies from HeLa cells indicated a steady increase in transfection efficiency with increasing cationic charge and decreasing polyplex size. Cell growth inhibition assay showed significant growth inhibition by the polyplexes coupled with weak cytotoxicity, indicating effective ODN delivery. While this study has confirmed the overall charge effect, it has also revealed progressive structural changes of the polyplexes against varying charge ratio, thereby providing useful insight into the mechanistic process behind the ODN delivery. 相似文献
12.
Delivery of cationic polymer-siRNA nanoparticles for gene therapies in neural regeneration 总被引:1,自引:0,他引:1
Liang Y Liu Z Shuai X Wang W Liu J Bi W Wang C Jing X Liu Y Tao E 《Biochemical and biophysical research communications》2012,421(4):690-695
The therapeutic applications of neural stem cells (NSCs) have potential to promote recovery in many obstinate diseases in central nervous system. Regulation of certain gene expressions using siRNA may have significant influence on the fate of NSC. To achieve the optimum gene silencing effect of siRNA, non-viral vector polyethylene glycol-polyethyleneimine (PEG-PEI) was investigated in the delivery of siRNA to NSCs. The characteristics of PEG-PEI/siRNA polyplexes were detected by scanning electron microscopy (SEM). The effects of nanoparticles on cell viability were measured via CCK-8 assay. In addition, the transfection efficiency was evaluated by fluorescence microscope and flow cytometry, and real-time PCR and Western Blot were employed to detect the gene inhibition effect of siRNA delivered by PEG-PEI. The SEM micrographs showed that PEG-PEI could condense siRNA to form diffuse and spherical nanoparticles. The cytotoxicity of PEG-PEI/siRNA nanocomplexes (N/P=15) was significantly lower when compared with that of Lipofectamine 2000/siRNA (P<0.05). Moreover, the highest transfection efficiency of PEG-PEI/siRNA nanoparticles was obtained at an N/P ratio of 15, which was better than that achieved in the transfection using Lipofectamine 2000 (P<0.05). Finally, the gene knockdown effect of PEG-PEI/siRNA nanoparticles was verified at the levels of mRNA and protein. These results suggest that PEG-PEI may potentially be used as a siRNA delivery vector for neural regeneration therapy. 相似文献
13.
Extracellular barriers to in Vivo PEI and PEGylated PEI polyplex-mediated gene delivery to the liver 总被引:2,自引:0,他引:2
Polyplex-mediated gene therapy is a promising alternative to viral gene therapy. One challenge to these synthetic carriers is reduced transfection efficiencies in vivo compared to those achieved in vitro. Many of the intracellular barriers to gene delivery have been elucidated, but similar quantification of extracellular barriers to gene delivery remains a need. In this study, the unpackaging of polyplexes by serum proteins, soluble glycosaminoglycans, and an extracellular matrix extract was demonstrated by a YOYO-1 fluorescence quenching assay. Additionally, exposing polyplexes to serum or proteoglycans before in vitro transfection caused decreased cellular uptake of DNA. Lastly, PEI polyplexes and PEGylated PEI polyplexes were injected into the portal vein of mice, and the intrahepatic distributions of labeled DNA and polymer were assessed by confocal microscopy. PEI polyplexes delivered DNA to the liver, but extensive vector unpackaging was observed, with PEI primarily colocalized with the extracellular matrix. PEGylated polyplexes mediated less DNA delivery to the liver, possibly due to premature vector unpackaging in the blood. Through this work, both the blood and the extracellular matrix have been determined to be significant extracellular barriers to polyplex-mediated in vivo gene delivery to the liver. 相似文献
14.
Acetylation of polyethylenimine enhances gene delivery via weakened polymer/DNA interactions 总被引:1,自引:0,他引:1
We previously reported that gene delivery efficiency of 25-kDa, branched polyethylenimine (PEI) increased upon acetylation of up to 43% of the primary amines with acetic anhydride. In the present work, we investigated the effects of further increasing the degree of acetylation and elucidated the source of the higher gene delivery efficiency. Despite reduced buffering capacity, gene delivery activity continued to increase (up to 58-fold in HEK293) with acetylation of up to 57% of primary amines but decreased at higher degrees of acetylation. Characterization of polymer-DNA interactions showed that acetylated polymers bind less strongly to DNA. Further, a fluorescence resonance energy transfer assay showed that increasing acetylation causes polyplexes to unpackage inside cells to a higher degree than polyplexes formed with unmodified PEI. Overall, the data suggest that the increased gene delivery activity may be attributable to an appropriate balance between polymer buffering capacity and strength of polymer/DNA interactions. 相似文献
15.
Xu P Li SY Li Q Ren J Van Kirk EA Murdoch WJ Radosz M Shen Y 《Biotechnology and bioengineering》2006,95(5):893-903
Viral-mediated gene delivery has been explored for the treatment and protection of cardiomyocytes, but so far there is only one report using cationic polymer for gene delivery to cardiomyocytes in spite of many advantages of polymer-mediated gene delivery. In this study, a cationic poly(beta-amino ester) (PDMA) with a degradable backbone and cleavable side chains was synthesized by Michael addition reaction. The toxicity of PDMA to neonatal mouse cardiomyocytes (NMCMs) was significantly lower than that of polyethyleneimine (PEI). PDMA formed stable polyplexes with pEGFP. The dissociation of the polyplexes could be triggered by PDMA degradation, and the dissociation time was tunable via the polymer/pEGFP ratio. In vitro transfection showed that PDMA was an effective and low toxic gene delivery carrier for NMCMs. The PDMA/pEGFP polyplexes transfected EGFP gene to NMCMs with about 28% efficiency and caused little death. In contrast, a significant portion of cardiomyocytes cultured with PEI/pEGFP died. 相似文献
16.
Purification of polyethylenimine polyplexes highlights the role of free polycations in gene transfer
Boeckle S von Gersdorff K van der Piepen S Culmsee C Wagner E Ogris M 《The journal of gene medicine》2004,6(10):1102-1111
BACKGROUND: Nonviral vectors based on polyethylenimine (PEI) usually contain an excess of PEI that is not complexed to DNA. Since unbound PEI contributes to cellular and systemic toxicity, purification of polyplexes from unbound PEI is desirable. METHODS: Size exclusion chromatography (SEC) was used to purify PEI polyplexes of free PEI. Transfection properties of purified polyplexes and the effect of free PEI on gene delivery were studied in vitro and in vivo after systemic application into mice. RESULTS: SEC did not change the size and zeta-potential of polyplexes. Independent of the amount of PEI used for complex formation, purified PEI polyplexes had the same final PEI nitrogen/DNA phosphate ratio of 2.5. Notably, purified PEI polyplexes demonstrated low cellular and systemic toxicity. High transfection efficiency was achieved with purified polyplexes at high DNA concentrations (8-15 microg/ml). At low DNA concentrations (2-4 microg/ml) gene transfer with purified particles was less efficient than with polyplexes containing free PEI both in vitro and in vivo. Mechanistic studies showed that free PEI partly blocked cellular association of DNA complexes but was essential for the following intracellular gene delivery. Adding free PEI to cells treated with purified particles with a delay of up to 4 h resulted in significantly enhanced transfection efficiency compared with non-purified particles or purified particles without free PEI. CONCLUSIONS: This study presents an efficient method to remove free PEI from PEI polyplexes by SEC. Our results from transfection experiments demonstrate that free PEI substantially contributes to efficient gene expression but also mediates toxic effects in a dose-dependent manner. Purified polyplexes without free PEI have to be applied at increased concentrations to achieve high transfection levels, but exhibit a greatly improved toxicity profile. 相似文献
17.
Shcharbin D Pedziwiatr E Chonco L Bermejo-Martín JF Ortega P de la Mata FJ Eritja R Gómez R Klajnert B Bryszewska M Muñoz-Fernandez MA 《Biomacromolecules》2007,8(7):2059-2062
Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery. 相似文献
18.
Rait A Pirollo K Will DW Peyman A Rait V Uhlmann E Chang EH 《Bioconjugate chemistry》2000,11(2):153-160
Activation of the ras oncogene has been implicated in many types of human tumors. It has been shown that downmodulation of ras expression can lead to the reversion of the transformed phenotype of these tumor cells. Antisense oligodeoxyribonucleotides (ODNs) can inhibit gene expression by hybridization to complementary mRNA sequences. To minimize toxicity associated with all-phosphorothioated ODNs and improve cellular uptake, we used partially phosphorothioate (PPS)-modified ODNs having an additional hydrophobic tail at the 3'-end (PPS-C(16)). The PPS ODNs are protected against degradation by PS internucleotide linkages at both the 3'- and 5'-ends and additionally stabilized at internal pyrimidine sites, which are the major sites of endonuclease cleavage. Here we show that anti-ras PPS-C(16) ODN retains the high sequence-specificity of PPS ODNs and provides maximal inhibition of Ras p21 synthesis with minimal toxicity even without the use of a cellular uptake enhancer. Moreover, treatment of T24, a radiation-resistant human tumor cell line that carries a mutant ras gene, with anti-ras PPS-C(16) ODN resulted in a reduction in the radiation resistance of the cells in vitro. We also demonstrate that the growth of RS504 (a human c-Ha-ras transformed NIH/3T3 cell line) mouse tumors was significantly inhibited by the combination of intratumoral injection of anti-ras PPS-C(16) ODN and radiation treatment. These findings indicate the potential of this combination of antisense and conventional radiation therapy as a highly effective cancer treatment modality. 相似文献
19.
Mao S Neu M Germershaus O Merkel O Sitterberg J Bakowsky U Kissel T 《Bioconjugate chemistry》2006,17(5):1209-1218
Polyplexes between siRNA and poly(ethylene imine) (PEI) derivatives are promising nonviral carriers for siRNA. The polyplex stability is of critical importance for efficient siRNA delivery to the cytoplasm. Here, we investigate the effect of PEGylation at a constant ratio ( approximately 50%) on the biophysical properties of the polyplexes. Particle size, zeta potential, and stability against heparin as well as RNase digestion and reporter gene knockdown under in vitro conditions of different siRNA polyplexes were characterized. Stability and size of siRNA polyplexes were clearly influenced by PEI-PEG structure, and high degrees of substitution such as PEI(25k)-g-PEG(550)(30) resulted in large (300-400 nm), diffuse complexes (AFM) which showed condensation behavior only at high N/P ratios. All other polyplexes and the PEI control showed similar sizes (150 nm) and compact structures in AFM, with complete condensation reached at N/P ratio of 3. Stability of siRNA polyplexes against heparin displacement and RNase digestion could be modified by PEGylation. Protection against RNase digestion was highest for PEI(25k)-g-PEG(5k)(4) and PEI(25k)-g-PEG(20k)(1), while siRNA/PEI provided insufficient protection. In knockdown experiments using NIH/3T3 fibroblasts stably expressing beta-galactosidase, it was shown that PEG chain length had a significant influence on biological activity of siRNA. Polyplexes with siRNA containing PEI(25k)-g-PEG(5k)(4) and PEI(25k)-g-PEG(20k)(1) yielded similar efficiencies of ca. 70% knockdown as lipofectamine controls. Confocal microscopy demonstrated enhanced cellular uptake of siRNA into cytosol by polyplexes formation with PEI copolymers. In conclusion, both the chain length and graft density of PEG were found to strongly influence siRNA condensation and stability and hence affect the knockdown efficiency of PEI-PEG/siRNA polyplexes. 相似文献
20.
An antisense oligodeoxynucleotide (ODN) delivery system based on polyelectrolyte complex (PEC) micelles composed of an ODN-poly(ethylene glycol) (PEG) conjugate and polyethylenimine (PEI) was demonstrated. The PEC micelles having a core/shell structure were spontaneously formed in an aqueous solution by ionic interactions between ODN part in the conjugate and PEI. The ODN/PEI polyelectrolyte complex formed an inner core while PEG chains surrounded it as a shell. The morphology of the micelles was visualized as a separate sphere by atomic force microscopy (AFM). When the micelles containing a c-raf antisense ODN were intravenously administered into tumor-bearing nude mice, significant antitumor activities against human lung cancer were observed. The intravenously injected micelles also showed significantly higher accumulation level in the solid tumor region compared to that of naked ODN. 相似文献