Spectroscopic properties of oligonucleotides excised from the anticodon region of phenylalanine tRNA from yeast

Ultraviolet absorption and static fluorescence properties of hexanucleotide (Gm-A-A-Y-A-ψp) and a dodecanucleotide (A-Cm-U-Gm-A-A-Y-A-ψ-m⁵C-U-Gp) excised from the anticodon region of phenylalanine tRNA from yeast have been studied with respect to temperature, pH, ionic strength, and Mg²⁺ concentration. At low temperature these oligomers have a largely stacked structure. Only the melting data of the dodecanucleotide in absence of Mg²⁺ fit a two-state model. From the different melting behavior of the oligonucleotides after excision of base Y, a rodlike structure of the hexanucleotide produced by stacking interactions can be concluded. The Y fluorescence increase produced by Mg²⁺ has been used to evaluate the binding equilibria between Mg²⁺ and the oligonucleotides. One strong binding site per oligonucleotide and a greater number of weak binding sites have been found. The fluorescence of the free base Y is not influenced by Mg²⁺. The dodecanucleotide enhances the ethidium fluorescence to the same extent as tRNA^Phe and produces comparable shifts in the excitation and emission spectra. Therefore a double helical structure for this oligomer under the assay conditions is suggested. Only weak binding of ethidium to the hexanucleotide is observed, indicating that intercalation of the dye into its structure is not favored. The data show the decisive role of the nucleobase Y in maintaining a rigid stacked structure of the anticodon nucleotides. This structure is stabilized by high ionic strength, Mg²⁺, and ethidium.     

Nuclear magnetic resonance studies of codon-anticodon interaction in tRNAPhe. I. Effect of binding complementary tetra and pentanucleotides to the anticodon

The effect of codon-anticodon interaction on the structure of two tRNA^Phe species was investigated by means of nuclear magnetic resonance spectroscopy. To this end n.m.r.² spectra of yeast and Escherichia coli tRNA^Phe were recorded in the absence and the presence of the oligonucleotides U-U-C-A, U-U-C-G and U-U-C-A-G, which all contain the sequence UUC complementary to the anticodon sequence GAA. The spectra of the hydrogen-bonded protons, the methyl protons and the internucleotide phosphorous nuclei served to monitor the structure of the anticodon loop and of the tRNA in the tRNA-oligonucleotide complex. From the changes in the methyl proton spectra and in the phosphorous spectra it could be concluded that the oligonucleotides bind to the anticodon. Moreover it turned out that the binding constants obtained from these n.m.r. experiments were, within experimental error, equal to the values obtained with other techniques. Using the resonances of the protons hydrogen-bonded between the oligonucleotide and the anticodon loop the structure of the latter could be studied. In particular, binding of the pentanucleotide U-U-C-A-G, which is complementary to the five bases on the 5′ side of the anticodon loop, resulted in the resolution of four to five extra proton resonances indicating that four to five base-pairs are formed between the pentanucleotide and the anticodon loop. The formation of five base-pairs was confirmed by an independent fluorescence binding study. The resonance positions of the hydrogen-bonded protons indicate, that an RNA double helix is formed by the anticodon loop and U-U-C-A-G with the five base-pairs forming a continuous stack. This structure can be accomodated in the so-called 5′ stacked conformation of the anticodon loop, a structure that has been suggested earlier as an alternative to the familiar 3′ stacked conformation in the crystal structure models of yeast tRNA^Phe. It turned out that structural adjustments of the anticodon loop to the binding of the oligonucleotides are propagated into the anticodon stem. The relevance of these results with respect to the mechanism of protein synthesis is discussed.     

Location of a platinum binding site in the structure of yeast phenylalanine transfer RNA

Trans-dichlorodiammineplatinum (II) reacts with yeast phenylalanine transfer RNA to yield a major platinum binding site. The tightly bound platinum has been located on the oligonucleotide Gm-A-A-Y-A-ψp containing the anticodon by standard fingerprinting methods using ³²P-labelled tRNA^Phe. This site corresponds to a single major platinum site identified during an X-ray crystallographic analysis of yeast tRNA^Phe. The solution studies have given confidence to the assignment of part of the 3 Å electron density map to the anticodon region of the molecular structure of yeast tRNA^Phe.     

Conformational Change of the L-Shaped tRNAPhe Molecule

Abstract

Fluorophore of proflavine was introduced onto the 3′-terminal ribose moiety of yeast tRNA^Phe. The distance between the fluorophore and the fluorescent Y base in the anticodon of yeast tRNA^Phe was measured by a singlet-singlet energy transfer. Conformational changes of tRNA^Phe with binding of tRNA^Glu ₂, which has the anticodon UUC complementary to the anticodon GAA of tRNA^Phe, were investigated. The distance obtained at the ionic strength of 100 mM K⁺ and 10 mM Mg²⁺ is very close to the distance from x-ray diffraction, while the distance obtained in the presence of tRNA^Glu ₂ is significantly smaller. Further, using a fluorescent probe of 4-bromomethl-7-methoxycoumarin introduced onto pseudouridine residue Ψ₅₅ in the TΨC loop of tRNA^Phe, Stern-Volmer quenching experiments for the probe with or without added tRNA^Glu ₂were carried out. The results showed greater access of the probe to the quencher with added tRNA^Glu ₂. These results suggest that both arms of the L-shaped tRNA structure tend to bend inside with binding of tRNA^Glu ₂ and some structural collapse occurs at the corner of the L-shaped structure.     

Function of Y in codon-anticodon interaction of tRNA Phe

Molar association constants of binding oligonucleotides to the anticodon loops of (yeast) tRNA^Phe, (yeast) tRNA_HCl^Phe and (E. coli) tRNA_F^Met have been determined by equilibrium dialysis. From the temperature dependence of the molar association constants, ΔF, ΔH and ΔS of oligomer-anticodon loop interaction have been determined. The data indicate that the free energy change of codon-anticodon interaction is highly influenced by the presence of a modified purine (tRNA^Phe), of an unmodified purine (tRNA_F^Met) or its absence (tRNA_HCl^Phe). Excision of the modified purine Y in the anticodon loop of tRNA^Phe results in a conformational change of the anticodon loop, which is discussed on the basis of the corresponding changes in ΔF, ΔH and ΔS.     

Conformation effects of base modification on the anticodon stem-loop of Bacillus subtilis tRNA(Tyr)

tRNA molecules contain 93 chemically unique nucleotide base modifications that expand the chemical and biophysical diversity of RNA and contribute to the overall fitness of the cell. Nucleotide modifications of tRNA confer fidelity and efficiency to translation and are important in tRNA-dependent RNA-mediated regulatory processes. The three-dimensional structure of the anticodon is crucial to tRNA-mRNA specificity, and the diverse modifications of nucleotide bases in the anticodon region modulate this specificity. We have determined the solution structures and thermodynamic properties of Bacillus subtilis tRNA^Tyr anticodon arms containing the natural base modifications N⁶-dimethylallyl adenine (i⁶A₃₇) and pseudouridine (ψ₃₉). UV melting and differential scanning calorimetry indicate that the modifications stabilize the stem and may enhance base stacking in the loop. The i⁶A₃₇ modification disrupts the hydrogen bond network of the unmodified anticodon loop including a C₃₂-A₃₈⁺ base pair and an A₃₇-U₃₃ base-base interaction. Although the i⁶A₃₇ modification increases the dynamic nature of the loop nucleotides, metal ion coordination reestablishes conformational homogeneity. Interestingly, the i⁶A₃₇ modification and Mg²⁺ are sufficient to promote the U-turn fold of the anticodon loop of Escherichia coli tRNA^Phe, but these elements do not result in this signature feature of the anticodon loop in tRNA^Tyr.     

Complex formation between transfer RNAs with complementary anticodons: use of matrix bound tRNA

It is shown that yeast tRNA^Phe, chemically coupled by its oxidized 3′CpCpA end behaves exactly as free tRNA^Phe in its ability to form a specific complex with $\text{E. coli}$ tRNA₂^Glu having a complementary anticodon. The results support models of tRNA in which the 3′CpCpA_OH end and the anticodon are not closely associated in the tertiary structure, and provide a convenient tool of general use to characterize others pairs of tRNA having complementary anticodons, as well as for highly selective purification of certain tRNA species.     

Study of the Mechanism of Interaction of Oligonucleotides with the 3′-Terminal Region of tRNA<Superscript>Phe</Superscript> by Computer Modeling

Three-dimensional atomic models of complexes between yeast tRNA^Phe and 10- or 15-mer oligonucleotides complementary to the 3′-terminal tRNA sequence have been constructed using computer modeling. It has been found that rapidly formed primary complexes appear when an oligonucleotide binds to the coaxial acceptor and T stems of the tRNA^Phe along the major groove, which results in the formation of a triplex. Long stems allow the formation of a sufficiently strong complex with the oligonucleotide, which delivers its 3′-terminal nucleotides to the vicinity of the T loop adjoining the stem. These nucleotides destabilize the loop structure and initiate conformational rearrangements involving local tRNA^Phe destruction and formation of the final tRNA^Phe-oligonucleotide complementary complex. The primary complex formation and the following tRNA^Phe destruction constitute the “molecular wedge” mechanism. An effective antisence oligonucleotide should consist of three segments—(1) complex initiator, (2) primary complex stabilizer, and (3) loop destructor—and be complementary to the (free end)/loop-stem-loop tRNA structural element.     

Nucleoside Modifications Affect the Structure and Stability of the Anticodon of tRNALys,3

Abstract

NMR spectroscopy was used to determine the solution structures of RNA oligonucleotides comprising the anticodon domain of tRNA^Lys,3. The structural effects of the pseudouridine modification at position 39 were investigated and are well correlated with changes in thermodynamic parameters. The loop conformation differs from that seen in tRNA^Phe and provides an explanation of the critical role of modification in this tRNA.     

Codon:Anticodon and anticodon:Anticodon interaction. Evaluation of equilibrium and kinetic parameters of complexes involving a G:U wobble

In order to learn about the effect of the G:U wobble interaction we characterized the codon:anticodon binding between triplets: UUC, UUU and yeast tRNA^Phe (anticodon GmAA) as well as the anticodon:anticodon binding between Escherichia coli tRNA^Glu₂, E. coli tRNA^Lys (anticodons: mam⁵s²UUC, and mam⁵s²UUU, respectively) and tRNA^Phe from yeast and E. coli (anticodon GAA) using equilibrium fluorescence titrations and temperature jump measurements with fluorescence and absorption detection. The difference in stability constants between complexes involving a G:U pair rather than a usual G:C basepair is in the range of one order of magnitude and is mainly due to the shorter lifetime of the complex involving G:U in the wobble position. This difference is more pronounced when the codon triplet is structured, i.e., is built in the anticodon loop of a tRNA. The reaction enthalpies of the anticodon:anticodon complexes involving G:U mismatching were found to be about 4 kcal/mol smaller, and the melting temperatures more than 20°C lower, than those of the corresponding complexes with the G:C basepair. The results are discussed in terms of different strategies that might be used in the cell in order to minimize the effect of different lifetimes of codon-tRNA complexes. Differences in these lifetimes may be used for the modulation of the translation efficiency.     

Isolation and chromatographic behaviour of phenylalanine tRNA from barley embryos

Two fractions of phenylalanine tRNA (tRNA^Phe₁ and tRNA^Phe₂) were purified by BD-cellulose and RPC-5 chromatography of crude tRNA isolated from barley embryos. Successive RPC-5 rechromatography runs of tRNA^Phe₂ showed its conversion into more stable tRNA^Phe₁, suggesting that the two fractions have essentially the same primary structure. Both tRNA^Phe₁ and tRNA^Phe₂ had about the same acceptor activity, but tRNA^Phe₂ was aminoacylated much faster than tRNA^Phe₁. RPC-5 chromatography of crude aminoacylated tRNA showed higher contents of phe-tRNA^Phe₂ than of phe-tRNA^Phe₁ but the ratio of these two fractions estimated by relative fluorescence intensity was about 1. Fluorescence spectra of tRNA^Phe from barley embryos suggest that it contains Y base similar to Y_w from wheat tRNA^Phe.     

Study of the phosphorescent bases of yeast phenylalanine transfer RNA with the aid of optical detection of magnetic resonance

The phosphorescence of brewers' yeast phenylalanine transfer RNA has been investigated at 77 °K and at 1.2 °K in pumped liquid helium. Although the phosphorescence at 77 °K originates almost completely from the Y base in the anticodon loop, independent of excitation wavelength, the phosphorescence originates from normal bases with 270 nm excitation at temperatures in the helium range. The low-temperature phosphorescence is assigned to the triplet state of adenosine by optical detection of magnetic resonance measurements. The adenosine phosphorescence at 1.2 °K is quenched by the binding of the codon poly(U), as well as by the removal of Mg²⁺. The former result indicates that the adenosine phosphorescence originates from the anticodon, -Gm-A-A-, while the second shows that a conformational change introduced by removing Mg²⁺ (possibly involving unstacking of the anticodon) prevents energy trapping in the anticodon triplet state. The lack of triplet energy transfer from anticodon to Y indicates that Y cannot be stacked with the anticodon in the conformation that is stable at helium temperature. The adenosine phosphorescence of transfer RNA^Phe is nearly completely quenched at 77 °K, at least partially due to energy transfer to Y. We think that the thermally activated energy transfer is associated with some mobility of the Y base at 77 °K. Our observations are in contrast with previous results on bakers' yeast tRNA^Phe where there is apparently little, if any, energy transfer to Y from the normal nucleotides at 80 °K with 265 nm excitation. Optically detected magnetic resonance measurements on the triplet state of Y base in various environments indicate that removal of Mg²⁺ causes a shift of the Y base in tRNA^Phe to a more solvent-exposed position, whereas the binding of poly(U) has little effect on the environment of Y.     

The structure of yeast tRNAAsp. A model for tRNA interacting with messenger RNA

Abstract

The anticodon of yeast tRNA^Asp, GUC, presents the peculiarity to be self-complementary, with a slight mismatch at the uridine position. In the orthorhombic crystal lattice, tRNA^Asp molecules are associated by anticodon-anticodon interactions through a two-fold symmetry axis. The anticodon triplets of symmetrically related molecules are base paired and stacked in a normal helical conformation. A stacking interaction between the anticodon loops of two two-fold related tRNA molecules also exists in the orthorhombic form of yeast tRNA^Phe. In that case however the GAA anticodon cannot be base paired. Two characteristic differences can be correlated with the anticodon-anticodon association: the distribution of temperature factors as determined from the X-ray crystallographic refinements and the interaction between T and D loops. In tRNA^Asp T and D loops present higher temperature factors than the anticodon loop, in marked contrast to the situation in tRNA^Phe. This variation is a consequence of the anticodon-anticodon base pairing which rigidities the anticodon loop and stem. A transfer of flexibility to the corner of the tRNA molecule disrupts the G19-C56 tertiary interactions. Chemical mapping of the N3 position of cytosine 56 and analysis of self-splitting patterns of tRNA^Asp substantiate such a correlation.     

The distance between the anticodon loops of two tRNAs bound to the 70 S Escherichia coli ribosome.

Using singlet-singlet energy transfer, we have measured the distance between the anticodons of two transfer RNAs simultaneously bound to a messengerprogramed Escherichia coli 70 S ribosome. The fluorescent Y base adjacent to the anticodon of yeast tRNA_Y^Phe serves as a donor. A proflavine (Pf) chemically substituted for the Y base in tRNA_Pf^Phe serves as an acceptor. By exploiting the sequential binding properties of 70 S ribosomes for two deacylated tRNAs, we can fill the strong site with either tRNA_Y^Phe or tRNA_Pf^Phe and then the weak site with the other tRNA. In both cases donor quenching and sensitized emission of the acceptor are observed. Analysis of these results leads to an estimate for the Y-proflavine distance of 18 ± 2 Å. This distance is very short and suggests strongly that the two tRNAs are simultaneously in contact with adjacent codons of the message. Separate experiments show that binding of a tRNA to the weak site does not perturb the environment of the hypermodified base of a tRNA bound to the strong site. This supports the assignment of the strong site as the peptidyl site. It also indicates that binding of the second tRNA proceeds without a change in the anticodon structure of a pre-existing tRNA at the peptidyl site.     

Transfer RNA Identity Change in Anticodon Variants of E. coli tRNAPhe in Vivo

The anticodon sequence is a major recognition element for most aminoacyl-tRNA synthetases. We investigated the in vivo effects of changing the anticodon on the aminoacylation specificity in the example of E. coli tRNA^Phe. Constructing different anticodon mutants of E. coli tRNA^Phe by site-directed mutagenesis, we isolated 22 anticodon mutant tRNA^Phe; the anticodons corresponded to 16 amino acids and an opal stop codon. To examine whether the mutant tRNAs had changed their amino acid acceptor specificity in vivo, we tested the viability of E. coli strains containing these tRNA^Phe genes in a medium which permitted tRNA induction. Fourteen mutant tRNA genes did not affect host viability. However, eight mutant tRNA genes were toxic to the host and prevented growth, presumably because the anticodon mutants led to translational errors. Many mutant tRNAs which did not affect host viability were not aminoacylated in vivo. Three mutant tRNAs containing anticodon sequences corresponding to lysine (UUU), methionine (CAU) and threonine (UGU) were charged with the amino acid corresponding to their anticodon, but not with phenylalanine. These three tRNAs and tRNA^Phe are located in the same cluster in a sequence similarity dendrogram of total E. coli tRNAs. The results support the idea that such tRNAs arising from in vivo evolution are derived by anticodon change from the same ancestor tRNA.     

Codon-Anticodon Binding in tRNA<Superscript>phe</Superscript>

THE anticodon loop of tRNA^phe of baker's yeast has the sequence (5′ to 3′) AY A A MeG U MeC. The unusual base Y, adjacent to the anticodon (AA MeG), is the only nucleotide in this tRNA which fluoresces at room temperature and because it absorbs to the red of all other bases, the excitation energy is localized on it exclusively. (7-Methyl guanine is another base in tRNA^phe which fluoresces in these conditions but its emission is so weak that it can only be observed in tRNA^phe from which Y has been excised.) The fluorescence spectrum undergoes a small blue shift in the presence of the complementary codon¹ and we report now the use of this shift to determine the association constants for this binding at several temperatures. The results suggest a simple thermodynamic model for the codon recognition step during protein synthesis.     

The conformation of the anticodon loop of yeast tRNAPhe in solution and on ribosomes.

The Y-base of yeast tRNA^Phe was replaced by the fluorophores 1-aminoanthracene or proflavine to yield derivatives which are active in all of the reactions of peptide elongation on reticulocyte ribosomes. The relatively long lifetime, higher quantum yield, and environmental sensitivity of 1-aminoanthracene make it a particulary useful adjunct to the Y-base in studying conformational changes in the anticodon region. The absorption and emission spectra of 1-aminoanthracene in tRNA in solutions in which it is active in peptide synthesis indicate that the probe is in a hydrophobic environment, apparently provided by stacking with the adjacent bases in the anticodon loop. The proflavine derivative, tRNA, was employed in iodide quenching, D₂O enhancement, and fluorescence depolarization experiments. The results indicate that the fluorophore in partially but not completely protected from the solvent. Anisotropy studies indicate that in solutions approximating those which support peptide synthesis on ribosomes, the probes have significant but restricted flexibility within the anticodon loop. Considered with nmr data and Y-base fluorescence from crystals of tRNA, the results indicate that the solution and crystal structures of tRNA^Phe are very similar. In turn, fluorescene from modified tRNA^Phe bound to ribosomes is similar to that observed in solution. It is of special significance for future experiments involving nonradiative energy transfer that these probles adjacent to the anticodon retain independent flexibility when bound to ribosomes with poly(U). The tRNA^Phe itself appears to be held rigidly on the ribosomes. It is concluded that within the limits dictated by the position and sensitivity of the probes used in this study, the mechanism of tRNA^Phe binding to ribosomes and the movement of tRNA and mRNA during the translocation steps of peptide synthesis can be interpreted in terms of the well-defined crystal structure of tRNA^Phe.     

Sequence studies on tRNAPhe from placenta: comparison with known sequences of tRNAPhe from other normal mammalian tissues.

Phenylalanine-specific tRNA was isolated from human placenta and degraded to mixtures of oligonucleotides. Tritium sequence analysis of the digestion products indicates that the sequence of human placenta tRNA^Phe is identical to that of calf liver tRNA^Phe and differs only slightly from that of rabbit liver tRNA^Phe.     

Interaction of manganese with fragments, complementary fragment recombinations, and whole molecules of yeast phenylalanine specific transfer RNA

Binding of Mn²⁺ to the whole molecule, fragments and complementary fragment recombinations of yeast tRNA^Phe, and to synthetic polynucleotides was studied by equilibrium dialysis. The comparison of the binding patterns of the fragments, fragment recombinations and synthetic polynucleotides with that of intact tRNA^Phe permits reasonable conclusions concerning the nature and location of the various classes of sites on tRNA^Phe. Binding of Mn²⁺ to intact tRNA^Phe consists of a co-operative and a non-co-operative phase. There are about 17 “strong” sites and several “weak” ones. Five of the 17 strong sites are associated with the co-operative phase. This phase is completely lacking in the binding of Mn²⁺ to tRNA^Phe fragments (5′-$\text{1}\text{2}$, 3′-$\text{1}\text{2}$, 5′-$\text{3}\text{5}$, 3′-$\text{2}\text{5}$), poly-(A):poly(U) and poly(I):poly(C) helices, and single stranded poly(A) and poly(U). This argues that the co-operative sites arise from the tRNA tertiary structure. This conclusion is further strengthened by the observation that cooperativity is present in a tRNA^Phe molecule which has been split in the anticodon loop, but it is absent in one which has been split in the extra loop. It is in the vicinity of the latter loop, but not the former, that tertiary interactions are seen in the crystal structure. The remaining 12 strong sites are “independent” and appear to be associated with cloverleaf helical sections.     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.