Evolution of the Tyrosinase Related Gene (TYRL) in Primates

Tyrosinase is the major enzyme responsible for the formation of melanin pigment and is found throughout the animal kingdom. In humans, the tyrosinase gene (TYR) maps to the long arm of chromosome 11 at band q14→q21, while a tyrosinase related gene (TYRL) maps to the short arm of chromosome 11 at pll.2°Cen. We and others have found that the TYRL locus contains sequences that are similar to exons IV and V of the authentic tyrosinase gene but lacks sequences of exons I, II, and III. In an attempt to understand the evolution of the human tyrosinase gene, we have analyzed TYR and TYRL in primates and have found that exons IV and V of the chimpanzee and gorilla TYR are very similar to the human, with the gorilla sequence being more similar than the chimpanzee. We have also found that the gorilla but not the chimpanzee contains a TYRL locus similar to the human TYRL locus.     

Carboxyl ester lipase: a highly polymorphic locus on human chromosome 9qter.

Carboxyl ester lipase (CEL) is a major component of pancreatic juice and is responsible for the hydrolysis of cholesterol esters as well as a variety of other dietary esters. As part of an effort to elucidate the role of this enzyme in the genetic control of lipid metabolism, we report here the chromosomal mapping of the gene for CEL to the most distal part of the long arm of human chromosome 9 using analysis of mouse-human somatic cell hybrids and in situ hybridization to chromosomes. A chromosome 9 translocation was utilized to determine the position of the CEL gene relative to various genetic markers previously localized to this region. Finally, we report that the CEL locus exhibits a high degree of polymorphism and contains a hypervariable region of the insertion/deletion variety.     

Hydrolysis of triacylglycerol arachidonic and linoleic acid ester bonds by human pancreatic lipase and carboxyl ester lipase

The hydrolysis of polyenoic fatty acid ester bonds with pure human colipase-dependent lipase, with carboxyl ester lipase (CEL) and with these enzymes in combination was studied, using [3H]arachidonic- and [14C]linoleic acid-labelled rat chylomicrons as a model substrate. During the hydrolysis with colipase-dependent lipase, the amount of 3H appearing in 1,2-X-diacylglycerol (DG) markedly exceeded that of 14C. When CEL was added in addition this [3H]DG was efficiently hydrolyzed. CEL alone hydrolyzed the triacylglycerol (TG) at a low rate. The hydrolysis pattern with human duodenal content was similar to that seen with colipase-dependent lipase and CEL in combination. Increasing the concentration of taurodeoxycholate (TDC) and taurocholate (TC) or of TDC alone stimulated the hydrolysis of [3H]- and [14C]TG, but increased the accumulation of labelled DG that could act as substrate for CEL. It is suggested that very-long-chain polyenoic fatty acids of DG formed during the action of the colipase-dependent lipase on TG containing these fatty acids may be a physiological substrate for CEL.     

Cloning of a novel member of the reticulon gene family (RTN3): gene structure and chromosomal localization to 11q13.

A novel member of the neuron-specific protein (NSP) or newly named reticulon (RTN) gene family was isolated during a subtraction cloning between macula and peripheral retina. The mRNA for this NSP/RTN-like gene is approximately threefold more abundant in macula than in peripheral retina. The cDNA is 2527 bp long and contains an open reading frame of 236 amino acids. The deduced peptide shows a strong similarity to the NSP/RTN and tropomyosin-like gene families but it is clearly a novel member. The gene contains seven exons and spans more than 15 kb. The gene was localized to chromosome 11q13 between markers D11S4535 and D11S4627 using somatic cell hybrid panels. Southern blot analysis identified the presence of a pseudogene(s) that was subsequently localized to chromosome 4. Multitissue Northern blot analysis found this gene to be widely expressed in human tissues with the highest expression in the brain. We are calling this gene RTN3 to reflect the newly proposed nomenclature.     

Comparative and genetic analysis of the porcine glucocerebrosidase (GBA) gene

The genomic sequence of the porcine (Sus scrofa) glucocerebrosidase (GBA) gene (5.7 kb), encoding glucocerebrosidase (glucosylceramidase; acid beta-glucosidase; EC 3.2.1.45), was determined and compared with human (Homo sapiens) GBA and GBAP (pseudogene). The porcine gene harbours 11 exons and 10 introns, and the genomic organization is identical with human GBA. The exon sequences, coding for signal peptide and mature protein, show 81% and 90% sequence identity, respectively, with the corresponding human GBA sequences. Short interspersed elements, SINEs (PREs), are present in introns 2, 4 and 7. There is no evidence of a pseudogene in pig. The deduced protein sequence of GBA consists of 39 amino acids of signal peptide (long form) and 497 amino acids of the mature protein; the latter shows 90% sequence identity with the human protein. Four polymorphisms were observed within the porcine gene: insertion/deletion of one of the two SINEs (PREs) in intron 2 (locus PREA); deletion of a 37- to 39-bp stretch in intron 4 (one direct repeat and 5′ end of PRE); deletion of a 47-bp stretch in the middle part of PRE in intron 4 (locus PREB); and single-base transition (C–T) in intron 6 (locus HaeIII–RFLP). GBA was assigned to chromosome 4q21 by FISH and was localized to the same region by linkage analysis and RH mapping, i.e., to the chromosome 4 segment where quantitative trait loci for growth and some carcass traits are located.     

Effect of pancreatic phospholipase A2 and gastric lipase on the action of pancreatic carboxyl ester lipase against lipid substrates in vitro.

Preincubation of a triolein/phospholipid/cholesteryl oleate-emulsion in vitro with either pancreatic phospholipase A2 (PLA2) or gastric lipase (GL) resulted in hydrolysis (measured by pH-stat-titration) of cholesteryl [3H]oleate only after human pancreatic carboxyl ester lipase (CEL) was added to the system. No appreciable hydrolysis was observed when CEL was added alone. Consequently, a concerted action either of PLA2 and CEL or of GL and CEL made the substrate cholesteryl oleate available for hydrolysis by CEL. This was the case when cholesteryl oleate was solubilised in a phospholipid-stabilised triglyceride emulsion, which is the physico-chemical form in which the major part of dietary cholesteryl esters are presented to the gastro-intestinal tract of man.     

Intestinal absorption of dietary cholesteryl ester is decreased but retinyl ester absorption is normal in carboxyl ester lipase knockout mice

Carboxyl ester lipase (CEL; EC 3.1.1.13) hydrolyzes cholesteryl esters and retinyl esters in vitro. In vivo, pancreatic CEL is thought to liberate cholesterol and retinol from their esters prior to absorption in the intestine. CEL is also a major lipase in the breast milk of many mammals, including humans and mice, and is thought to participate in the processing of triglycerides to provide energy for growth and development while the pancreas of the neonate matures. Other suggested roles for CEL include the direct facilitation of the intestinal absorption of free cholesterol and the modification of plasma lipoproteins. Mice with different CEL genotypes [wild type (WT), knockout (CELKO), heterozygote] were generated to study the functions of CEL in a physiological system. Mice grew and developed normally, independent of the CEL genotype of the pup or nursing mother. Consistent with this was the normal absorption of triglyceride in CELKO mice. The absorption of free cholesterol was also not significantly different between CELKO (87 +/- 26%, mean +/- SD) and WT littermates (76 +/- 10%). Compared to WT mice, however, CELKO mice absorbed only about 50% of the cholesterol provided as cholesteryl ester (CE). There was no evidence for the direct intestinal uptake of CE or for intestinal bacterial enzymes that hydrolyze it, suggesting that another enzyme besides CEL can hydrolyze dietary CE in mice. Surprisingly, CELKO and WT mice absorbed similar amounts of retinol provided as retinyl ester (RE). RE hydrolysis, however, was required for absorption, implying that CEL was not the responsible enzyme. The changes in plasma lipid and lipoprotein levels to diets with increasing lipid content were similar in mice of all three CEL genotypes. Overall, the data indicate that in the mouse, other enzymes besides CEL participate in the hydrolysis of dietary cholesteryl esters, retinyl esters, and triglycerides.     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

Isolation and genomic analysis of the human surf-6 gene: a member of the Surfeit locus

The human Surfeit locus contains at least six tightly clustered genes (Surf-1 to Surf-6) of which five (Surf-1 to Surf-5) have been characterised and found not to share any sequence homology. The organisation and juxtaposition of the Surfeit genes are conserved between human and mouse. The Surf-6 gene that encodes a novel nucleolar-matrix protein with nucleic-acid binding properties has been characterised in mouse. In this work, we have isolated and analysed the human Surf-6 homologue and determined its genomic organisation in the Surfeit locus. The human Surf-6 gene has five exons spread over a distance of 4.3kb and has features of a housekeeping gene being ubiquitously expressed, having its 5' end located within a CpG rich island and lacking a canonical TATA box. The intragenic region between the 3' end of the Surf-5 gene and the 5' end of the Surf-6 gene is 3.2kb and contains a pseudogene of the ribosomal protein gene rpL21. The putative human Surf-6 protein is 361 amino acids long and includes motifs found in both the mouse and fish Surf-6 homologues, which may underlie the functions of Surf-6. Three amino acid polymorphisms have been detected at codons 163, 175 and 311 by SSCP analysis.     

Cloning, genomic structure, and expression profiles of TULIP1 (GARNL1), a brain-expressed candidate gene for 14q13-linked neurological phenotypes, and its murine homologue

Previously, we have described the clinical and molecular characterization of a de novo 14q13.1-q21.1 microdeletion, less than 3.5 Mb in size, in a patient with severe microcephaly, psychomotor retardation, and other clinical anomalies. Here we report the characterization of the genomic structure of the human tuberin-like protein gene 1 (TULIP1; approved gene symbol GARNL1), a CpGisland-associated, brain-expressed candidate gene for the neurological findings in our patient, and its murine homologue. The human TULIP1 gene was mapped to chromosome band 14q13.2 by fluorescence in situ hybridization of BAC clone RP11-355C3 (GenBank Accession No. AL160231), containing the 3' region of the gene. TULIP1 spans about 271 kb of human genomic DNA and is divided into 41 exons. An untranscribed, processed pseudogene of TULIP1 was found on human chromosome band 9q31.1. The active locus TULIP1, encoding a predicted protein of 2036 amino acids, is expressed ubiquitously in pre- and postnatal human tissues. The murine homologue Tulip1 spans about 220 kb of mouse genomic DNA and is also divided into 41 exons, encoding a predicted protein of 2035 amino acids. No pseudogene could be found in the available mouse sequence data. Several splicing variants were found. Considering the location, expression profile, and predicted function, TULIP1 is a strong candidate for several neurological features seen in 14q deletion patients. Additionally we searched for mutations in the coding region of TULIP1 in subjects from a family with idiopathic basal ganglia calcification (IBGC; Fahr disease), previously linked to chromosome 14q. We identified two novel SNPs in the intron-exon boundaries; however, they did not segregate only with affected subjects in the predicted model of an autosomal dominant disease such as IBGC.     

Isolation, cDNA, and Genomic Structure of a Conserved Gene (NOF) at Chromosome 11q13 Next to FAU and Oriented in the Opposite Transcriptional Orientation

In our effort to characterize a gene at chromosome 11q13 involved in a t(11;17)(q13;q21) translocation in B-non-Hodgkin lymphoma, we have identified a novel human gene, NOF (Neighbour of FAU). It maps right next to FAU in a head to head configuration separated by a maximum of 146 nucleotides. cDNA clones representing NOF hybridized to a 2.2-kb mRNA present in all tissues tested. The largest open reading frame appeared to contain 166 amino acids and is proline rich, and the sequence shows no homology with any known gene in the public databases. The NOF gene consists of 4 exons and 3 introns spanning approximately 5 kb, and the boundaries between exons and introns follow the GT/AG rule. The NOF locus is conserved during evolution, with the predicted protein having over 80% identity to three translated mouse and rat ESTs of unknown function. Moreover, the mouse ESTs map in the same organization, closely linked to the FAU gene, in the mouse genome. NOF, however, is not affected by the t(11;17)(q13;q21) chromosomal translocation.