Advances in the analysis of isothermal titration calorimetry data for ligand-DNA interactions

Isothermal titration calorimetry (ITC) is a well established technique for the study of biological interactions. The strength of ITC is that it directly measures enthalpy changes associated with interactions. Experiments can also yield binding isotherms allowing quantification of equilibrium binding constants, hence an almost complete thermodynamic profile can be established. Principles and application of ITC have been well documented over recent years, experimentally the technique is simple to use and in ideal scenarios data analysis is trivial. However, ITC experiments can be designed such that previously inaccessible parameters can be evaluated. We outline some of these advances, including (1) exploiting different experimental conditions; (2) low affinity systems; (3) high affinity systems and displacement assays. In addition we ask the question: What if data cannot be fit using the fitting functions incorporated in the data-analysis software that came with your ITC? Examples where such data might be generated include systems following non 1:n binding patterns and systems where binding is coupled to other events such as ligand dissociation. Models dealing with such data are now appearing in literature and we summarise examples relevant for the study of ligand-DNA interactions.     

Application of isothermal titration calorimetry and column chromatography for identification of biomolecular targets

This protocol describes a method for identifying unknown target proteins from a mixture of biomolecules for a given drug or a lead compound. This method is based on a combination of chromatography and isothermal titration calorimetry (ITC) where ITC is used as a tracking tool. The first step involves the use of ITC to confirm the binding of ligand to a component in the biomolecular mixture. Subsequently, the biomolecular mixture is fractionated by chromatography, and the binding of the ligand with individual fractions (or subfractions) is verified by ITC. The iteration of chromatographic purification on the fractions combined with ITC results in identifying the target protein. This method is useful when the target protein or ligand is unknown and/or not amenable to labeling, chemical modification or immobilization. This protocol has been successfully used by our team and by others to identify both low-abundance and highly abundant target proteins present in biomolecular mixtures. With this protocol, it takes approximately 3-5 d to identify the target protein from a mixture.     

Simultaneous determination of thermodynamic and kinetic data by isothermal titration calorimetry

BackgroundThermodynamic and binding kinetic data increasingly support and guide the drug optimization process.MethodsBecause ITC thermograms contain binding thermodynamic and kinetic information, an efficient protocol for the simultaneous extraction of thermodynamic and kinetic data for 1:1 protein ligand reactions from AFFINImeter kinITC in one single experiment are presented.ResultsThe effort to apply this protocol requires the same time as for the standard protocol but increases the precision of both thermodynamic and kinetic data.ConclusionsThe protocol enables reliable extraction of both thermodynamic and kinetic data for 1:1 protein-ligand binding reactions with improved precision compared to the ‘standard protocol’.General significanceThermodynamic and kinetic data are recorded under exactly the same conditions in solution without any labeling or immobilization from a protein sample that is not 100% active and would otherwise render the extraction of kinetic parameters impossible.     

Isothermal Titration Calorimetry for Measuring Macromolecule-Ligand Affinity

Isothermal titration calorimetry (ITC) is a useful tool for understanding the complete thermodynamic picture of a binding reaction. In biological sciences, macromolecular interactions are essential in understanding the machinery of the cell. Experimental conditions, such as buffer and temperature, can be tailored to the particular binding system being studied. However, careful planning is needed since certain ligand and macromolecule concentration ranges are necessary to obtain useful data. Concentrations of the macromolecule and ligand need to be accurately determined for reliable results. Care also needs to be taken when preparing the samples as impurities can significantly affect the experiment. When ITC experiments, along with controls, are performed properly, useful binding information, such as the stoichiometry, affinity and enthalpy, are obtained. By running additional experiments under different buffer or temperature conditions, more detailed information can be obtained about the system. A protocol for the basic setup of an ITC experiment is given.     

Comparative thermodynamic analysis of cyclic nucleotide binding to protein kinase A

We have investigated the thermodynamic parameters and binding of a regulatory subunit of cAMP-dependent protein kinase (PKA) to its natural low-molecular-weight ligand, cAMP, and analogues thereof. For analysis of this model system, we compared side-by-side isothermal titration calorimetry (ITC) with surface plasmon resonance (SPR). Both ITC and SPR analyses revealed that binding of the protein to cAMP or its analogues was enthalpically driven and characterised by similar free energy values (DeltaG=-9.4 to -10.7 kcal mol-1) for all interactions. Despite the similar affinities, binding of the cyclic nucleotides used here was characterised by significant differences in the contribution of entropy (-TDeltaS) and enthalpy (DeltaH) to DeltaG. The comparison of ITC and SPR data for one cAMP analogue further revealed deviations caused by the method. These equilibrium parameters could be complemented by thermodynamic data of the transition state (DeltaHnot equal, DeltaGnot equal, DeltaSnot equal) for both association and dissociation measured by SPR. This direct comparison of ITC and SPR highlights method-specific advantages and drawbacks for thermodynamic analyses of protein/ligand interactions.     

Survey of the year 2009: applications of isothermal titration calorimetry

Isothermal titration calorimetry (ITC) is now an established and invaluable method for determining the thermodynamic constants, association constant and stoichiometry of molecular interactions in aqueous solutions. The technique has become widely used by biochemists to study protein interaction with other proteins, small molecules, metal ions, lipids, nucleic acids and carbohydrates; and nucleic acid interaction with small molecules. The drug discovery industry has utilized this approach to measure protein (or nucleic acid) interaction with drug candidates. ITC has been used to screen candidates, guide the design of potential drugs and validate the modelling used in structure-based drug design. Emerging disciplines including nanotechnology and drug delivery could benefit greatly from ITC in enhancing their understanding and control of nano-particle assembly, and drug binding and controlled release.     

Applications of isothermal titration calorimetry – the research and technical developments from 2011 to 2015

Isothermal titration calorimetry is a widely used biophysical technique for studying the formation or dissociation of molecular complexes. Over the last 5 years, much work has been published on the interpretation of isothermal titration calorimetry (ITC) data for single binding and multiple binding sites. As over 80% of ITC papers are on macromolecules of biological origin, this interpretation is challenging. Some researchers have attempted to link the thermodynamics constants to events at the molecular level. This review highlights work carried out using binding sites characterized using x‐ray crystallography techniques that allow speculation about individual bond formation and the displacement of individual water molecules during ligand binding and link these events to the thermodynamic constants for binding. The review also considers research conducted with synthetic binding partners where specific binding events like anion‐π and π‐π interactions were studied. The revival of assays that enable both thermodynamic and kinetic information to be collected from ITC data is highlighted. Lastly, published criticism of ITC research from a physical chemistry perspective is appraised and practical advice provided for researchers unfamiliar with thermodynamics and its interpretation. Copyright © 2016 John Wiley & Sons, Ltd.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

On the link between conformational changes,ligand binding and heat capacity

BackgroundConformational changes coupled to ligand binding constitute the structural and energetics basis underlying cooperativity, allostery and, in general, protein regulation. These conformational rearrangements are associated with heat capacity changes. ITC is a unique technique for studying binding interactions because of the simultaneous determination of the binding affinity and enthalpy, and for providing the best estimates of binding heat capacity changes.Scope of reviewStill controversial issues in ligand binding are the discrimination between the “conformational selection model” and the “induced fit model”, and whether or not conformational changes lead to temperature dependent apparent binding heat capacities. The assessment of conformational changes associated with ligand binding by ITC is discussed. In addition, the “conformational selection” and “induced fit” models are reconciled, and discussed within the context of intrinsically (partially) unstructured proteins.Major conclusionsConformational equilibrium is a major contribution to binding heat capacity changes. A simple model may explain both conformational selection and induced fit scenarios. A temperature-independent binding heat capacity does not necessarily indicate absence of conformational changes upon ligand binding. ITC provides information on the energetics of conformational changes associated with ligand binding (and other possible additional coupled equilibria).General significancePreferential ligand binding to certain protein states leads to an equilibrium shift that is reflected in the coupling between ligand binding and additional equilibria. This represents the structural/energetic basis of the widespread dependence of ligand binding parameters on temperature, as well as pH, ionic strength and the concentration of other chemical species. This article is part of a Special Issue entitled Microcalorimetry in the BioSciences — Principles and Applications, edited by Fadi Bou-Abdallah.     

The thermodynamic signature of ligand binding to histone deacetylase-like amidohydrolases is most sensitive to the flexibility in the L2-loop lining the active site pocket

BackgroundThe analysis of the thermodynamic driving forces of ligand-protein binding has been suggested to be a key component for the selection and optimization of active compounds into drug candidates. The binding enthalpy as deduced from isothermal titration calorimetry (ITC) is usually interpreted assuming single-step binding of a ligand to one conformation of the target protein. Although successful in many cases, these assumptions are oversimplified approximations of the reality with flexible proteins and complicated binding mechanism in many if not most cases. The relationship between protein flexibility and thermodynamic signature of ligand binding is largely understudied.MethodsDirected mutagenesis, X-ray crystallography, enzyme kinetics and ITC methods were combined to dissect the influence of loop flexibility on the thermodynamics and mechanism of ligand binding to histone deacetylase (HDAC)-like amidohydrolases.ResultsThe general ligand-protein binding mechanism comprises an energetically demanding gate opening step followed by physical binding. Increased flexibility of the L2-loop in HDAC-like amidohydrolases facilitates access of ligands to the binding pocket resulting in predominantly enthalpy-driven complex formation.ConclusionsThe study provides evidence for the great importance of flexibility adjacent to the active site channel for the mechanism and observed thermodynamic driving forces of molecular recognition in HDAC like enzymes.General significanceThe flexibility or malleability in regions adjacent to binding pockets should be given more attention when designing better drug candidates. The presented case study also suggests that the observed binding enthalpy of protein-ligand systems should be interpreted with caution, since more complicated binding mechanisms may obscure the significance regarding potential drug likeness.     

Ligand binding affinity determined by temperature-dependent circular dichroism: cyclin-dependent kinase 2 inhibitors

To support drug discovery efforts for cyclin-dependent kinase 2 (CDK2), a moderate-throughput binding assay that can rank order or estimate the affinity of lead inhibitors has been developed. The method referred to as temperature-dependent circular dichroism (TdCD) uses the classical temperature-dependent unfolding of proteins by circular dichroism (CD) to measure the degree of protein unfolding in the absence and presence of potential inhibitors. The midpoint of unfolding is the Tm value. Rank ordering the affinity and predictions of the dissociation constant of compounds is obtained by measuring the increase in Tm for different protein-inhibitor complexes. This is the first time an extensive characterization of the TdCD method has been described for characterizing lead inhibitors in a drug discovery mode. The method has several favorable properties. Using the new six-cell Peltier temperature controller for the Jasco 810 spectropolarimeter, one can determine the affinity of 12-18 compounds per day. The method also requires only 20-40 microg protein per sample and can be used to estimate the affinity of compounds with dissociation constants of picomolar to micromolar. An important property of the method for lead discovery is that dissociation constants of approximately 5 microM can be estimated from a single experiment using a low concentration of compound such as 20 microM, which is generally low enough for most small molecules to be soluble for testing. In addition, the method does not require labeling the compound or protein. Although other methods such as isothermal titration calorimetry (ITC) can provide a full thermodynamic characterization of binding, ITC requires 1-2 mg protein per sample, cannot readily determine binding constants below nanomolar values, is most versatile with soluble compounds, and has a throughput of two to three experiments per day. The ITC method is not usually used in a high-throughput drug discovery mode; however, using the thermodynamic information from several ITC experiments can make the TdCD method very robust in determining reliable binding constants. Using the kinase inhibitors BMS-250595, purvalanol B, AG-12275, flavopiridol, and several other compounds, it is demonstrated that one can obtain excellent comparisons between the Kd values of binding to CDK2 obtained by TdCD and ITC.     

A Thermodynamic Characterization of the Binding of Thrombin Inhibitors to Human Thrombin, Combining Biosensor Technology, Stopped-Flow Spectrophotometry, and Microcalorimetry

The binding of a series of low-molecular-mass, active-site-directed thrombin inhibitors (399-575 Da) to human alpha-thrombin was investigated by surface plasmon resonance technology (BIACORE), stopped-flow spectrophotometry, and isothermal titration microcalorimetry (ITC). The equilibrium constants K(D) (nM to microM range) at 25 degrees C obtained from the BIACORE analysis correlated well with the inhibition constants K(i) in a chromogenic inhibition assay. The interactions between thrombin and three potent inhibitors, melagatran, inogatran, and CH-248, were further investigated at temperatures between 278 and 310K. A one-to-one binding stoichiometry found with ITC was supported by BIACORE data. K(i) and K(D) values increased with the temperature, mainly due to higher values for dissociation rate constants. The changes in enthalpy, DeltaH, and entropy, DeltaS, determined from the linear van't Hoff plots (R coefficient > 0.99), were linearly correlated by chemical compensation. Both techniques indicated clear differences in DeltaS for the three inhibitors, with a strong correlation to the number of rotational bonds. Immobilization of thrombin increased the binding stability at higher temperature and reduced the DeltaH by 20 kJ mol(-1). DeltaH values obtained from the inhibition kinetics and BIACORE were thus not identical, but correlated well with ITC data obtained at 37 degrees C. The two thermodynamic techniques allowed further differentiation between compounds of similar affinity; furthermore, kinetic analysis, hence analysis of the transition state, is complementary to ITC. A direct BIACORE binding assay might be a useful alternative to more elaborate inhibition studies.     

Isothermal titration calorimetry of metal ions binding to proteins: An overview of recent studies

Isothermal titration calorimetry (ITC) is a technique that is capable of quantifying the stoichiometry, equilibrium constants and thermodynamics of molecular binding events. Thus, important information about the interaction of metal ions with biological macromolecules can be obtained with ITC measurements. This review highlights many of the recent studies of metal ions binding to proteins that have used ITC to quantify the thermodynamics of metal-protein interactions.     

Direct measurement of equilibrium constants for high-affinity hemoglobins

The biological functions of heme proteins are linked to their rate and affinity constants for ligand binding. Kinetic experiments are commonly used to measure equilibrium constants for traditional hemoglobins comprised of pentacoordinate ligand binding sites and simple bimolecular reaction schemes. However, kinetic methods do not always yield reliable equilibrium constants with more complex hemoglobins for which reaction mechanisms are not clearly understood. Furthermore, even where reaction mechanisms are clearly understood, it is very difficult to directly measure equilibrium constants for oxygen and carbon monoxide binding to high-affinity (K(D) < 1 micro M) hemoglobins. This work presents a method for direct measurement of equilibrium constants for high-affinity hemoglobins that utilizes a competition for ligands between the "target" protein and an array of "scavenger" hemoglobins with known affinities. This method is described for oxygen and carbon monoxide binding to two hexacoordinate hemoglobins: rice nonsymbiotic hemoglobin and Synechocystis hemoglobin. Our results demonstrate that although these proteins have different mechanisms for ligand binding, their affinities for oxygen and carbon monoxide are similar. Their large affinity constants for oxygen, 285 and approximately 100 micro M(-1) respectively, indicate that they are not capable of facilitating oxygen transport.     

Impact of protein and ligand impurities on ITC-derived protein–ligand thermodynamics

Background

The thermodynamic characterization of protein–ligand interactions by isothermal titration calorimetry (ITC) is a powerful tool in drug design, giving valuable insight into the interaction driving forces. ITC is thought to require protein and ligand solutions of high quality, meaning both the absence of contaminants as well as accurately determined concentrations.

Methods

Ligands synthesized to deviating purity and protein of different pureness were titrated by ITC. Data curation was attempted also considering information from analytical techniques to correct stoichiometry.

Results and conclusions

We used trypsin and tRNA-guanine transglycosylase (TGT), together with high affinity ligands to investigate the effect of errors in protein concentration as well as the impact of ligand impurities on the apparent thermodynamics. We found that errors in protein concentration did not change the thermodynamic properties obtained significantly. However, most ligand impurities led to pronounced changes in binding enthalpy. If protein binding of the respective impurity is not expected, the actual ligand concentration was corrected for and the thus revised data compared to thermodynamic properties obtained with the respective pure ligand. Even in these cases, we observed differences in binding enthalpy of about 4 kJ ⋅ mol^− 1, which is considered significant.

General significance

Our results indicate that ligand purity is the critical parameter to monitor if accurate thermodynamic data of a protein–ligand complex are to be recorded. Furthermore, artificially changing fitting parameters to obtain a sound interaction stoichiometry in the presence of uncharacterized ligand impurities may lead to thermodynamic parameters significantly deviating from the accurate thermodynamic signature.     

Interaction of porphyrin with G-quadruplex structures

Isothermal titration calorimetry (ITC) is a sensitive technique for probing bimolecular processes and can provide direct information about the binding affinity and stoichiometry and the key thermodynamic parameters involved. ITC has been used to investigate the interaction of the ligand H2TMPyP to the two DNA quadruplexes, [d(AGGGT)]4 and [d(TGGGGT)]. Analysis of the ITC data reveals that porphyrin/quadruplex binding stoichiometry under saturating conditions is 1:2 for [d(AGGGT)]4 and 2:1 for [d(TGGGGT)], respectively.     

Survey of the year 2008: applications of isothermal titration calorimetry

Isothermal titration calorimetry (ITC) is a fast, accurate and label‐free method for measuring the thermodynamics and binding affinities of molecular associations in solution. Because the method will measure any reaction that results in a heat change, it is applicable to many different fields of research from biomolecular science, to drug design and materials engineering, and can be used to measure binding events between essentially any type of biological or chemical ligand. ITC is the only method that can directly measure binding energetics including Gibbs free energy, enthalpy, entropy and heat capacity changes. Not only binding thermodynamics but also catalytic reactions, conformational rearrangements, changes in protonation and molecular dissociations can be readily quantified by performing only a small number of ITC experiments. In this review, we highlight some of the particularly interesting reports from 2008 employing ITC, with a particular focus on protein interactions with other proteins, nucleic acids, lipids and drugs. As is tradition in these reviews we have not attempted a comprehensive analysis of all 500 papers using ITC, but emphasize those reports that particularly captured our interest and that included more thorough discussions we consider exemplify the power of the technique and might serve to inspire other users. Copyright © 2010 John Wiley & Sons, Ltd.     

Thermodynamic stability of carbonic anhydrase: measurements of binding affinity and stoichiometry using ThermoFluor

ThermoFluor (a miniaturized high-throughput protein stability assay) was used to analyze the linkage between protein thermal stability and ligand binding. Equilibrium binding ligands increase protein thermal stability by an amount proportional to the concentration and affinity of the ligand. Binding constants (K(b)) were measured by examining the systematic effect of ligand concentration on protein stability. The precise ligand effects depend on the thermodynamics of protein stability: in particular, the unfolding enthalpy. An extension of current theoretical treatments was developed for tight binding inhibitors, where ligand effect on T(m) can also reveal binding stoichiometry. A thermodynamic analysis of carbonic anhydrase by differential scanning calorimetry (DSC) enabled a dissection of the Gibbs free energy of stability into enthalpic and entropic components. Under certain conditions, thermal stability increased by over 30 degrees C; the heat capacity of protein unfolding was estimated from the dependence of calorimetric enthalpy on T(m). The binding affinity of six sulfonamide inhibitors to two isozymes (human type 1 and bovine type 2) was analyzed by both ThermoFluor and isothermal titration calorimetry (ITC), resulting in a good correlation in the rank ordering of ligand affinity. This combined investigation by ThermoFluor, ITC, and DSC provides a detailed picture of the linkage between ligand binding and protein stability. The systematic effect of ligands on stability is shown to be a general tool to measure affinity.     

The development of a continuous isothermal titration calorimetric method for equilibrium studies

A continuous isothermal titration calorimetry (cITC) method for microcalorimeters has been developed. The method is based on continuous slow injection of a titrant into the calorimetric vessel. The experimental time for a cITC binding experiment is 12-20 min and the number of data points obtained is on the order of 1000. This gives an advantage over classical isothermal titration calorimetry (ITC) binding experiments that need 60-180 min to generate 20-30 data points. The method was validated using two types of calorimeters, which differ in calorimetric principle, geometry, stirring, and way of delivering the titrant into the calorimetric vessel. Two different experimental systems were used to validate the method: the binding of Ba(2+) to 18-crown-6 and the binding of cytidine 2'-monophosphate to RNAse A. Both systems are used as standard test systems for titration calorimetry. Computer simulations show that the dynamic range for determination of equilibrium constants can be increased by three orders of magnitude compared to that of classical ITC, making it possible to determine high affinities. Simulations also show an improved possibility to elucidate the actual binding model from cITC data. The simulated data demonstrate that cITC makes it easier to discriminate between different thermodynamic binding models due to the higher density of data points obtained from one experiment.