共查询到20条相似文献,搜索用时 15 毫秒
1.
Host Cell Participation in Small Virus Replication I. Replication of M-13 in a Strain of Escherichia coli with a Temperature-sensitive Lesion in Deoxyribonucleic Acid Synthesis 总被引:6,自引:3,他引:3 下载免费PDF全文
The replication of M-13 in a strain of Escherichia coli with a thermosensitive lesion in deoxyribonucleic acid synthesis was studied. M-13 failed to replicate at the restrictive temperature, even when the parental replicative form was allowed to form at the permissive temperature. When cells which were actively producing phage at the permissive temperature were shifted to the restrictive temperature, phage production continued. The incorporation of radioactive label into phage particles at 42 C indicated that continued single-strand synthesis was unaffected by the lesion in the host cell. 相似文献
2.
Replication of bacteriophage M13. 8. Differential effects of rifampicin and nalidixic acid on the synthesis of the two strands of M13 duplex DNA 总被引:5,自引:0,他引:5
Replication of bacteriophage M13 replicative forms is inhibited by rifampicin, an antibiotic that specifically inhibits the Escherichia coli RNA polymerase, and by nalidixic acid, an inhibitor of phage and bacterial DNA replication. Synthesis of the M13 complementary strand during RF3 replication was at least tenfold more sensitive to inhibition by rifampicin and by nalidixic acid than was that of the viral strand. Since M13 complementary strand synthesis is relatively insensitive to chloramphenicol, an inhibitor of protein synthesis, its inhibition by rifampicin suggests that complementary strands are initiated during RF replication by an RNA priming mechanism similar to that involved in parental RF formation. The nalidixic acid-sensitivity of complementary strand synthesis during RF replication clearly distinguishes this process from the nalidixic acid-resistant formation of the parental complementary strand in the conversion of the infecting single strand to RF.Production of progeny viral strands is indirectly affected by rifampiein in two ways. It prevents the conversion of supercoiled RF (RFI) to the open form (RFII), an essential step both in RF replication and in single-strand synthesis. In addition, rifampiein interferes with the expression of gene 5, an M13 gene function required for the accumulation of progeny viral strands. 相似文献
3.
Anastasia Tsaalbi-Shtylik Jill Moser Leon H. F. Mullenders Jacob G. Jansen Niels de Wind 《Nucleic acids research》2014,42(7):4406-4413
Rev3, the catalytic subunit of DNA polymerase ζ, is essential for translesion synthesis of cytotoxic DNA photolesions, whereas the Rev1 protein plays a noncatalytic role in translesion synthesis. Here, we reveal that mammalian Rev3−/− and Rev1−/− cell lines additionally display a nucleotide excision repair (NER) defect, specifically during S phase. This defect is correlated with the normal recruitment but protracted persistence at DNA damage sites of factors involved in an early stage of NER, while repair synthesis is affected. Remarkably, the NER defect becomes apparent only at 2 h post-irradiation indicating that Rev3 affects repair synthesis only indirectly, rather than performing an enzymatic role in NER. We provide evidence that the NER defect is caused by scarceness of Replication protein A (Rpa) available to NER, resulting from its sequestration at stalled replication forks. Also the induction of replicative stress using hydroxyurea precludes the accumulation of Rpa at photolesion sites, both in Rev3−/− and in wild-type cells. These data support a model in which the limited Rpa pool coordinates replicative stress and NER, resulting in increased cytotoxicity of ultraviolet light when replicative stress exceeds a threshold. 相似文献
4.
Purification and Characterization of Monovalent Cation-Activated Levodione Reductase from Corynebacterium aquaticum M-13 下载免费PDF全文
Masaru Wada Ayumi Yoshizumi Shigeru Nakamori Sakayu Shimizu 《Applied microbiology》1999,65(10):4399-4403
(6R)-2,2,6-Trimethyl-1,4-cyclohexanedione (levodione) reductase was isolated from a cell extract of the soil isolate Corynebacterium aquaticum M-13. This enzyme catalyzed regio- and stereoselective reduction of levodione to (4R,6R)-4-hydroxy-2,2,6-trimethylcyclohexanone (actinol). The relative molecular mass of the enzyme was estimated to be 142,000 Da by high-performance gel permeation chromatography and 36,000 Da by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The enzyme required NAD+ or NADH as a cofactor, and it catalyzed reversible oxidoreduction between actinol and levodione. The enzyme was highly activated by monovalent cations, such as K+, Na+, and NH4+. The NH2-terminal and partial amino acid sequences of the enzyme showed that it belongs to the short-chain alcohol dehydrogenase/reductase family. This is the first report of levodione reductase. 相似文献
5.
Cloning of a functional replication origin of phage G4 into the genome of phage M13. 总被引:9,自引:0,他引:9
A chimeric single-stranded DNA phage, M13Gori1, has been formed as a result of the in vitro insertion of a 2216 base-pair HaeII fragment of bacteriophage G4 replicative form DNA into the replicative form DNA of bacteriophage M13. The inserted G4 DNA carries the dnaG-dependent origin for G4 complementary strand synthesis. The cloned G4 origin functions both in vivo and in vitro in the conversion of M13Gori1 single-stranded viral DNA to the duplex replicative form by a rifampicin-resistant mechanism. Labelling of the 3′ terminus of the single discontinuity in M13Gori1 replicative form II molecules synthesized in crude extracts and subsequent restriction analysis indicate that M13Gori1 complementary strand synthesis can be initiated at either the RNA polymeraseprimed M13 origin or at the dnaG-primed G4 origin. The M13Gori1 complementary strand initiated at the G4 origin terminates in the vicinity of the G4 origin after progressing around the circular template and traversing the M13 origin region, indicating the absence of a specific nucleotide sequence in the M13 origin for termination of the newly formed complementary strand. The ability of this chimeric phage to utilize the cloned G4 origin in vivo even in the presence of the presumed M13 pilot protein (gene 3 protein) indicate that the nucleotide sequence of the replication origin is sufficient for recognizing the appropriate initiation enzymes. Since decapsidation of M13 is tightly coupled to replicative form formation, initiation at the G4 origin, located over 1000 nucleotides from the M13 complementary strand origin, indicates that widely separated nucleotide sequences contained in the filamentous virion can be exposed to the cell cytoplasm during eclipse. 相似文献
6.
Stefan Hertwig Andreas Popp Barbara Freytag Rudi Lurz Bernd Appel 《Applied microbiology》1999,65(9):3862-3866
To study phage-mediated gene transfer in Yersinia, the ability of Yersinia phages to transduce naturally occurring plasmids was investigated. The transduction experiments were performed with a temperate phage isolated from a pathogenic Yersinia enterocolitica strain and phage mixtures isolated from sewage. Small plasmids (4.3 and 5.8 kb) were transduced at a frequency of 10−5 to 10−7/PFU. However, we could not detect the transduction of any indigenous virulence plasmid (ca. 72 kb) in pathogenic Yersinia strains. Transductants obtained by infection with the temperate phage were lysogenic and harbored the phage genome in their chromosomes. 相似文献
7.
Hatsumi Taniguchi Kiyoshi Sato Midori Ogawa Takezo Udou Yasuo Mizuguchi 《Microbiology and immunology》1984,28(3):327-337
Phage Vf33, a filamentous phage about 1,400 nm long and 7 nm wide, specific for Vibrio parahaemolyticus, was isolated and characterized. The buoyant density of Vf33 in CsCl was 1.292 g/cm3. As with other filamentous phages, the lytic activity of Vf33 was resistant to heating below 80 C and to treatment with diethylether, acetone or methanol but sensitive to chloroform. The nucleic acid of this phage is single-stranded circular DNA 8.4 kb in size. The viral genome was converted to a double-stranded replicative form in the host cell. Among the strains tested, only V. parahaemolyticus strains possessing K38 antigen was sensitive to the phage. 相似文献
8.
Lloyd Matsumoto Harumi Kasamatsu Lajos Pik Jerome Vinograd 《The Journal of cell biology》1974,63(1):146-159
Mitochondrial DNA (mtDNA) replicative intermediates from Strongylocentrotus purpuratus oocytes were isolated by ethidium bromide-CsCl density gradient centrifugation and examined by electron microscopy after formamide spreading. In some experiments, the mtDNA was radioactively labeled by exposing isolated oocytes to [3H]thymidine. Oocyte mtDNA replication appears to follow the displacement loop model outlined in mouse L cells. There are differences in detail. The frequency of D-loop DNA is much lower in oocytes, suggesting that the relative holding time at the D-loop stage is shorter. Duplex synthesis on the displaced strand occurs early and with multiple initiations. The frequency of totally duplex replicative forms, or Cairns' forms, is the highest reported for mtDNA. The differences may be related to the fact that oocyte mtDNA replication occurs in the absence of cell division and need not be coordinated with a cell cycle. Molecules with expanded D loops banded in the intermediate region between the lower and upper bands in an ethidium bromide-CsCl gradient, supporting the notion that displacement replication proceeds on a closed circular template which is subject to nicking-closing cycles. In mature sea urchin eggs, replicative forms are absent and virtually all the mtDNA is stored as clean circular duplexes. Some novel structural variants of superhelical circular DNA (molecules with denaturation loops and double branch-migrated replicative forms) are reported. 相似文献
9.
Host functions required for replication of microvirid phage G13 DNA were investigated in vivo, using thermosensitive dna mutants of Escherichia coli. In dna+ bacteria, conversion of viral single-stranded DNA into double-stranded replicative form (stage I synthesis) was resistant to 150 microgram/ml of chloramphenicol or 200 microgram/ml of rifampicin. Although multiplication of G13 phage was severely inhibited at 42--43 degrees C even in dna+ host, considerable amount of parental replicative form was synthesized at 43 degrees C in dna+, dnaA or dnaE bacteria. In dnaB and dnaG mutants, however, synthesis of parental replicative form was severely inhibited at the restrictive temperature. Interestingly enough, stage I replication of G13 DNA was, unlike that of phiX174, dependent on host dnaC(D) function. Moreover, the stage I synthesis of G13 DNA in dnaZ was thermosensitive in nutrient broth but not in Tris/casamino acids/glucose medium. In contrast with the stage I replication, synthesis of G13 progeny replicative form was remarkably thermosensitive even in dna+ or dnA cells. 相似文献
10.
Phage Resistance in a Phage-Insensitive Strain of Streptococcus lactis: Temperature-Dependent Phage Development and Host-Controlled Phage Replication 总被引:6,自引:5,他引:1 下载免费PDF全文
Streptococcus lactis ME2 is a dairy starter strain that is insensitive to a variety of phage, including 18. The efficiency of plating of 18 on ME2 and N1 could be increased from <1 × 10−9 to 5.0 × 10−2 and from 7.6 × 10−7 to 2.1 × 10−2, respectively, when the host strains were subcultured at 40°C before plating the phage and the phage assay plates were incubated at 40°C. Host-dependent replication was demonstrated in N1 at 30°C and in N1 and ME2 at 40°C, suggesting the operation of a temperature-sensitive restriction and modification system in ME2 and N1. The increased sensitivity of ME2 and N1 to 18 at 40°C was also demonstrated by lysis of broth cultures and increased plaque size. ME2 grown at 40°C showed an increased ability to adsorb 18, indicating a second target for temperature-dependent phage sensitivity in ME2. Challenge of N1 with a 18 preparation that had been previously modified for growth on N1 indicated that at 40°C phage development was characterized by a shorter latent period and larger burst size than at 30°C. The evidence presented suggests that the high degree of phage insensitivity expressed by ME2 consists of a variety of temperature-sensitive mechanisms, including (i) the prevention of phage adsorption, (ii) host-controlled restriction of phage, and (iii) suppression of phage development. At 30°C these factors appear to act cooperatively to prevent the successful emergence of lytic phage active against S. lactis ME2. 相似文献
11.
A Mutant of E. COLI That Restricts Growth of Bacteriophage T4 at Elevated Temperatures 总被引:2,自引:0,他引:2 下载免费PDF全文
After nitrosoguanidine mutagenesis, a Phage Host Defective (phd) mutant of E. coli HfrH was isolated that supported the growth of T4D wild-type bacteriophage at 30°, but not at 40° or higher. Eleven independent spontaneous mutants of T4 (go mutants) were isolated that overcame the growth restriction at high temperature. All of these mutants were located within three percent recombination of a gene 39 amber mutation in the clockwise direction on the standard map. In mixed infections, the representative go mutant chosen for further study seems to be recessive to its wild-type allele. Temperature-shift experiments suggested that the mutated host function involved in phage growth is a "late" function, beginning in mid-eclipse.—Electrophoresis of phage proteins labelled early and late in infection showed that under restrictive conditions early protein synthesis was normal, but that certain late proteins were absent. However, measurements of DNA synthesis showed that under restrictive conditions the amount of phage DNA synthesized, and especially the amount of DNA sedimenting as high molecular weight replicative intermediate, was reduced. Pulse-chase experiments showed that the phage DNA made under restrictive conditions was not rapidly degraded. 相似文献
12.
Deoxyribonucleic Acid Synthesis in Bacteriophage SPO1-Infected Bacillus subtilis I. Bacteriophage Deoxyribonucleic Acid Synthesis and Fate of Host Deoxyribonucleic Acid in Normal and Polymerase-Deficient Strains 总被引:8,自引:6,他引:2 下载免费PDF全文
The effect of bacteriophage SPO1 infection of Bacillus subtilis and a deoxyribonucleic acid (DNA) polymerase-deficient (pol−) mutant of this microorganism on the synthesis of DNA has been examined. Soon after infection, the incorporation of deoxyribonucleoside triphosphates into acid-insoluble material by cell lysates was greatly reduced. This inhibition of host DNA synthesis was not a result of host chromosome degradation nor did it appear to be due to the induction of thymidine triphosphate nucleotidohydrolase. Examination of the host chromosome for genetic linkage throughout the lytic cycle indicated that no extensive degradation occurred. After the inhibition of host DNA synthesis, a new polymerase activity arose which directed the synthesis of phage DNA. This new activity required deoxyribonucleoside triphosphates as substrates, Mg2+ ions, and a sulfhydryl reducing agent, and it was stimulated in the presence of adenosine triphosphate. The phage DNA polymerase, like that of its host, was associated with a fast-sedimenting cell membrane complex. The pol− mutation had no effect on the synthesis of phage DNA or production of mature phage particles. 相似文献
13.
14.
Chunzhang Cao Juanjuan Zhao Emily K. Doughty Mary Migliorini Dudley K. Strickland Maricel G. Kann Li Zhang 《The Journal of biological chemistry》2015,290(35):21642-21651
Mac-1 exhibits a unique inhibitory activity toward IL-13-induced JAK/STAT activation and thereby regulates macrophage to foam cell transformation. However, the underlying molecular mechanism is unknown. In this study, we report the identification of IL-13Rα1, a component of the IL-13 receptor (IL-13R), as a novel ligand of integrin Mac-1, using a co-evolution-based algorithm. Biochemical analyses demonstrated that recombinant IL-13Rα1 binds Mac-1 in a purified system and supports Mac-1-mediated cell adhesion. Co-immunoprecipitation experiments revealed that endogenous Mac-1 forms a complex with IL-13Rα1 in solution, and confocal fluorescence microscopy demonstrated that these two receptors co-localize with each other on the surface of macrophages. Moreover, we found that genetic inactivation of Mac-1 promotes IL-13-induced JAK/STAT activation in macrophages, resulting in enhanced polarization along the alternative activation pathway. Importantly, we observed that Mac-1−/− macrophages exhibit increased expression of foam cell differentiation markers including 15-lipoxygenase and lectin-type oxidized LDL receptor-1 both in vitro and in vivo. Indeed, we found that Mac-1−/−LDLR−/− mice develop significantly more foam cells than control LDLR−/− mice, using an in vivo model of foam cell formation. Together, our data establish for the first time a molecular mechanism by which Mac-1 regulates the signaling activity of IL-13 in macrophages. This newly identified IL-13Rα1/Mac-1-dependent pathway may offer novel targets for therapeutic intervention in the future. 相似文献
15.
Restriction analysis of the duplex replicative forms of four cloned M13 miniphage indicates that all species examined contain a single copy of the intergenic space between genes II and IV plus one or more copies of a portion of the genome extending from within gene IV to a site in the HaeIII G fragment within the intergenic space. Both the viral and the complementary strand origins of replication have been localized previously within the 160 base-pair HaeIII G fragment. Since reiteration of a portion of the HaeIII G fragment could possibly lead to phages having multiple copies of the origin of replication, we have determined the location of the viral strand origin-terminus in M13 miniphage by mapping the position of the discontinuity(ies) in mini-RFII3 molecules isolated during asymmetric viral strand synthesis. Limited repair of late life-cycle mini-RFII molecules with DNA polymerase I in the presence of labeled deoxynucleoside triphosphates followed by restriction analysis demonstrates that the discontinuity in the RFII is contained at a unique site within the single HaeIII G fragment. The absence of a discontinuity in the reiterated DNA sequence containing only a portion of the HaeIII G fragment indicates that the reiterations of the origin region do not include the entire sequence specifying the viral strand origin-terminus. 相似文献
16.
Takehiko Kenzaka Masao Nasu Katsuji Tani 《Applied and environmental microbiology》2010,76(4):1274-1277
The transfer range of phage genes was investigated at the single-cell level by using an in situ DNA amplification technique. After absorption of phages, a phage T4 gene was maintained in the genomes of non-plaque-forming bacteria at frequencies of 10−2 gene copies per cell. The gene transfer decreased the mutation frequencies in nonhost recipients.Recently, whole-genome analyses have revealed that many bacterial genomes contain foreign genes, especially phage genes (9). The phage genes in bacterial genomes include genes for virulence or fitness factors such as extracellular toxins, superantigens, lipopolysaccharide-modifying enzymes, and proteins conferring serum resistance, etc. (1). These findings suggest that the horizontal transfer of phage genes has contributed significantly to the acquisition of new genetic traits and to the genetic diversity of bacteria (1, 9, 10). To truly appreciate the mechanisms behind phage-associated evolution, it is important to understand the frequency and range of transfer of phage genes.Most phage genomes consist of many genes derived from different origins (5, 8). Some genes are similar to those of other phages with phylogenetically different hosts or are found in the genomes of bacteria that are not the phage hosts. The mosaic nature of phage genomes has been known for some time, and a body of molecular genetic studies of phages to explain the mechanisms that drive this feature have been attempted previously (1, 5). More importantly, the horizontal transfer of phage genes has emerged as a major factor in the evolution of the phage genome. Since recombination between phage and phage/prophage can occur when these elements coexist in the same cell, coinfection with multiple phage species may result in the production of hybrid phage genomes (5). The pathways by which phages exchange genetic material vary dramatically in concert with host ranges. However, conventional plaque assays have shown that the host ranges of the phages studied are narrow. We hypothesized that phage genes can be transferred to more diverse species than previously thought.In order to accurately quantify DNA movement, gene targeting that does not require cultivation or gene expression is necessary (7). In situ DNA amplification methods allow the visualization of specific DNA sequences inside bacterial cells. In this study, we employed cycling primed in situ amplification-fluorescent in situ hybridization (CPRINS-FISH) to examine the possible range and frequency of the transfer of phage genes. CPRINS uses one primer and results in linear amplification of the target DNA inside cells, and multiply labeled fluorescent probe sets are applied for detection of the amplicons to improve the specificity and sensitivity of CPRINS (3). Previously, CPRINS-FISH did clarify the movement of DNA of a specific gene among Escherichia coli cells at the single-cell level (4).Enterobacterial phages P1 and T4 infect E. coli and have been well studied. P1 can exist as circular DNA within the bacterial cell as if it were a plasmid. Phage T4 is capable of undergoing only a lytic life cycle and not the lysogenic life cycle. Conventional methods using plaque assays have shown that the host of P1 and T4 is E. coli, but orthologous phage genes have been found in bacteria other than E. coli (6, 8). In the present study, strains of Enterobacteriaceae were allowed to grow on agar medium after the phage was adsorbed, and the maintenance of the transferred phage gene in the bacterial genomes was examined at the community level by quantitative real-time PCR and at the single-cell level by CPRINS-FISH.The following bacterial strains were used for maintenance experiments: Citrobacter freundii IFO 12681, Enterobacter aerogenes BM 2688, E. coli NBRC 12713, a Proteus mirabilis clinical isolate, Salmonella enterica serovar Enteritidis IID 640, and Yersinia enterocolitica IID 981. The bacterial strains were grown in Luria-Bertani (LB) medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl; Nacalai Tesque Inc., Kyoto, Japan) at 37°C overnight.Stationary-phase cultures of 500 μl were incubated with 500 μl of SM buffer (50 mmol liter−1 Tris-HCl [pH 7.5], 100 mmol liter−1 NaCl, 8 mmol liter−1 MgSO4, 0.01% gelatin) containing the phage P1kc NBRC 20008 (2) or T4GT7 (11) at 37°C for 10 min at a multiplicity of infection of 1:1 (ratio of PFU of the phage to CFU of the recipient bacterium). The concentration of bacterial cells was adjusted to 109 cells ml−1. After 10 min of incubation, the diluted cell suspension (105 cells) was filtered through a polycarbonate filter (Advantec, Tokyo, Japan) with a pore size of 0.2 μm and a diameter of 25 mm. Cells trapped on the filter were cultured on LB agar medium at 37°C for 24 h. The filter was transferred into a microtube, and cells on the filter were suspended in 1 ml of sterile deionized water. The numbers of cells in the suspension and cells remaining on the filter were determined by using an epifluorescence microscope (see below) after staining of the samples with 1 μg ml−1 of 4′,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich Japan, Tokyo). The level of recovery of cells from the filter into sterile deionized water was about 99%. The cultured cells were subjected to real-time PCR and CPRINS-FISH.For real-time PCR, bacterial DNA was extracted using a QIAamp DNA isolation kit (Qiagen, Tokyo, Japan). The cell suspension was mixed with 10 mg ml−1 of lysozyme solution and incubated at 37°C for 1 h. DNA extraction was then performed according to the kit manufacturer''s instructions. Table Table11 lists the oligonucleotide primers for PCR and CPRINS and the polynucleotide probes used in the present study. Tail fiber genes from phages P1kc and T4GT7 were quantified by real-time PCR with a LightCycler system (Roche Diagnostics, Tokyo, Japan). LightCycler FastStart DNA master SYBR green I (Roche Diagnostics) was used with 5 mmol liter−1 Mg2+ and 0.5 μmol liter−1 (each) primers targeting the tail fiber genes of P1kc (P1-tail931f and P1-tail1148r) and T4GT7 (T4-tail2770f and T4-tail2983r). After a hot start for 10 min at 95°C, 40 cycles of PCR were run with denaturation at 94°C for 15 s, annealing at 60°C for 10 s, extension at 72°C for 10 s, and fluorescence detection at 83°C for 5 s. The known amounts of PCR products from the phage DNA (101 to 107 copies per reaction) were used for the standard curves to quantify the target DNA. To confirm the specificity of the reaction after real-time PCR, the PCR mixture was collected in a glass capillary and subjected to agarose gel electrophoresis in addition to a melting-curve analysis with the LightCycler system. The maintenance frequencies determined by real-time PCR were recorded as the copy number of the phage tail fiber gene per bacterial genome detected by staining with PicoGreen (Invitrogen, Tokyo, Japan) after cultivation of cells on LB agar medium for 24 h as described above. The frequencies were determined in triplicate for each sample. The increase in the phage gene copy number was determined by comparing the copy numbers in cells on the filter before and after cultivation. The phage gene copy number in cells on the filter was determined by the following formula: (total number of cells determined by DAPI staining) × (phage tail fiber gene copy number determined by real-time PCR)/(bacterial genome copy number determined by PicoGreen staining).
Open in a separate windowCPRINS-FISH targeting the tail fiber gene of phage T4GT7 was performed as described by Kenzaka et al. (3, 4), except for the probe/primer sequences and thermal conditions. After cell wall permeabilization by lysozyme treatment (3), the CPRINS reaction was performed under the following conditions: a hot start at 95°C for 9 min, denaturation at 94°C for 1 min, annealing at 60°C for 30 s, and extension at 72°C for 1.5 min for primer T4-tail2983r. Amplification was repeated for 30 cycles by using a thermal cycler (PTC-200; Bio-Rad Laboratories, Inc.). After amplification, filters were rinsed with 0.1% Nonidet P-40 and sterile deionized water, dehydrated in 99% ethanol, and vacuum dried. Hybridization with Alexa Fluor 546-labeled polynucleotide probes (T4-tail2664, T4-tail2720, T4-tail2769, T4-tail2818, T4-tail2869, and T4-tail2922), washing, and DAPI staining were performed as described in a previous study (4). In order to exclude the possibility of nonspecific probe binding to cell structures other than the target DNA in the target cells, FISH using laboratory strains without amplification of target DNA and CPRINS-FISH targeting the tail fiber genes in E. coli strains that did not carry the genes were performed.In order to examine the infection ranges of phages, plaque assays and direct counting of phages were performed. Plaque assays were performed with LB soft agar (0.8% agar) as described by Kenzaka et al. (4). For the direct counting, phages were stained with 5× SYBR gold (Invitrogen, Tokyo, Japan) and trapped onto an Anodisc filter (Whatman Japan, Tokyo) with a pore size of 0.02 μm and a diameter of 25 mm.The cells or phage particles on the filters were observed under an epifluorescence microscope (E-400; Nikon, Tokyo, Japan) with the Nikon filter sets UV-2A (EX300-350, DM400, and BA420) for DAPI, B-2A (EX450-490, DM505, and BA520) for SYBR gold, and HQ-CY3 (G535/50, FT565, and BP610/75) for Alexa Fluor 546. Images were acquired using a Retiga 2000R cooled charge-coupled device camera (QImaging, Surrey, BC, Canada), and at least 2,000 DAPI- or SYBR gold-stained objects per sample were counted. The maintenance frequencies determined by CPRINS-FISH were recorded as the number of CPRINS-FISH-positive cells divided by the total direct count of recipient cells after cultivation as described above. The frequencies were determined in triplicate for each sample.After cultivation on LB agar medium for 24 h, the total number of cells on the filter as determined by DAPI staining increased by 8.7 × 102- to 1.1 × 104-fold (Table (Table2).2). Real-time PCR showed that the phage P1kc gene copy number increased only in plaque-forming strains (E. coli and E. aerogenes) and not in non-plaque-forming strains (Table (Table2).2). In contrast, the phage T4GT7 gene copy number increased in both plaque-forming and non-plaque-forming strains by 7.6 × 101- to 7.0 × 104-fold. The maintenance frequencies were more than 10−2 gene copies per bacterial genome (Table (Table2).2). Direct observation via epifluorescence microscopy showed that progeny phages were not produced in the non-plaque-forming strains (Table (Table2),2), and thus, fragments of phage genes were thought to integrate into the genomes of non-plaque-forming strains and replicate with the bacterial genomes.
Open in a separate windowaPlaque formation on soft agar was tested.bThe production of progeny phage particles was observed via epifluorescence microscopy.cThe increase (n-fold) in the total number of cells during bacterial growth for 24 h was determined via epifluorescence microscopy.dThe increase (n-fold) in the copy number of the phage tail fiber gene during bacterial growth for 24 h was determined by real-time PCR. Values in parentheses indicate standard deviations of results for triplicate samples.eMaintenance frequencies were determined by real-time PCR and CPRINS-FISH analyses targeting the phage tail fiber gene and are shown as the phage tail fiber gene copy numbers per bacterial genome and the numbers of gene-positive cells divided by the total numbers of cells, respectively. Values in parentheses indicate standard deviations of results for triplicate samples. ND, not determined.Real-time PCR provided a copy number for the target phage gene in the whole population, but the location of the target phage gene and the frequency of cells carrying the target gene were unclear. In addition, bacterial genomic DNA, which was measured using PicoGreen, included phage DNA, and thus the frequencies measured by dividing by the amount of bacterial genomic DNA were probably less accurate than those measured as described below. In order to confirm that the phage gene was located inside bacterial cells and determine a more accurate maintenance frequency for total cells, CPRINS-FISH targeting the tail fiber gene of phage T4GT7 was performed. CPRINS-FISH visualized the target phage gene in individual cells under an epifluorescence microscope (Fig. (Fig.1).1). It showed that the frequencies of maintenance of the tail fiber gene, expressed as the number of gene-positive cells divided by the total number of cells, were 2.1 × 10−1 to 4.0 × 10−1 for plaque-forming strains after growth on LB medium for 24 h (Table (Table2).2). Since phage T4GT7 is capable of undergoing only a lytic life cycle, CPRINS-FISH would detect cells in which the phage gene was replicating. For non-plaque-forming strains, the maintenance frequencies were 2.2 × 10−2 to 8.8 × 10−2 (Table (Table2).2). If the gene was amplified by the CPRINS reaction outside bacterial cells, the amplicon would not accumulate inside bacterial cells and they would not exhibit bright fluorescence. Therefore, CPRINS-FISH proved that a part of the phage T4GT7 gene was located inside cells of non-plaque-forming strains. The tail fiber gene is responsible for the phage tail structure. The DNA sequences of the phage genes responsible for phage morphology have been found in many bacterial genomes (1, 5).Open in a separate windowFIG. 1.Visualization of E. coli cells carrying the tail fiber gene transferred by phage T4GT7. (A) After being mixed with phages for 10 min, E. coli NBRC 12713 cells were cultured for 24 h and subjected to CPRINS-FISH targeting the phage gene. Only cells having amplified tail fiber gene products emitted the fluorescence of the Alexa Fluor 546-labeled probe under green excitation (exposure, 0.5 s). (B) All DAPI-stained bacterial cells were visualized under UV excitation (exposure time, 0.1 s).In order to explore the effect of integration of the phage gene into the bacterial genome on bacterial heredity, we determined the mutation frequency for a C. freundii strain that acquired the phage T4GT7 gene. Two colonies which acquired the phage T4GT7 gene were screened by colony PCR with T4-tail2770f and T4-tail2983r primers and designated Cik8-1 and Cik8-4. Mutation frequencies were determined with LB medium containing 150 μg ml−1of rifampin (rifampicin) or 10 μg ml−1of nalidixic acid. The mutation frequencies associated with nalidixic acid resistance decreased by 12- to 240-fold and the frequencies associated with rifampin resistance decreased by 40- to 83-fold compared to those for the parent strains (Fig. (Fig.2).2). Mutation increases genetic variation. The decreased mutation frequency would contribute to the genetic stability of the genome in individual cells but not to genetic variation in the population. Our results show that phage T4GT7 was capable of affecting the genomic properties of C. freundii, which was thought previously not to be the host, although the mechanism by which mutation frequencies decreased remains unknown. Further experiments are required to clarify the molecular mechanism by which mutation frequencies altered after gene transfer.Open in a separate windowFIG. 2.Mutation frequencies for T4GT7-infected C. freundii strains. Mutation frequencies were determined with LB agar medium containing nalidixic acid or rifampin. Cik8-1 and Cik8-4 were strains which acquired a phage gene transferred from phage T4GT7. Cik1 and Cik2 were the parent strains.In summary, during growth on agar medium after the phage was allowed to be adsorbed by strains of Enterobacteriaceae, the phage P1kc gene was not maintained in non-plaque-forming strains but the phage T4GT7 gene was maintained in more diverse species than previously expected. The transfer of foreign DNA molecules (DNA entry) into a bacterium is an important first step in genetic diversification through horizontal gene transfer. A previous study reported that phage P1kc is capable of injecting DNA into non-plaque-forming E. coli cells (4), but the phage P1kc gene was not maintained during bacterial growth in the present study. The results showing the difference in maintenance between phage P1kc and T4GT7 genes suggest that the maintenance of transferred phage genes depends on phage gene sequences or other phage factors. When maintained, the phage gene could alter the mutation frequency for bacteria that acquired the gene, affecting the genomic variability at the population level. Conventionally, phage-bacterium interaction has been studied with certain models consisting of a phage and a bacterium in which the phage can multiply (12, 13). Our results indicate the importance of the dynamic of phage genes among diverse bacteria that were previously thought not to be hosts and the hereditary impact of phage gene transfer on such bacteria. 相似文献
TABLE 1.
Probes and primers designed in this studyName | Target | Type | Nucleotide sequence (5′-3′) |
---|---|---|---|
P1-tail931f | Tail fiber gene of phage P1 | Primer | AACGACCCGAATTACAGCAC |
P1-tail1148r | Tail fiber gene of phage P1 | Primer | AGTGCTGCTGCAAGCTCATA |
T4-tail2770f | Tail fiber gene of phage T4 | Primer | AGCACAAATGGTGAGCACAG |
T4-tail2983r | Tail fiber gene of phage T4 | Primer | TTGCTACCGTGTGGGTATGA |
T4-tail2664 | Tail fiber gene of phage T4 | Probe | GGCTTCAAGTACTGACTTAGGTACTAAAACCACATCAAGCTTTGACTATGGTACG |
T4-tail2720 | Tail fiber gene of phage T4 | Probe | AAGGGAACTAACAGTACGGGTGGACACACTCACTCTGGTAGTGGTTCTA |
T4-tail2769 | Tail fiber gene of phage T4 | Probe | TAGCACAAATGGTGAGCACAGCCACTACATCGAGGCATGGAATGG |
T4-tail2818 | Tail fiber gene of phage T4 | Probe | GGTGTAGGTGGTAATAAGATGTCATCATATGCCATATCATACAGGGCGGG |
T4-tail2869 | Tail fiber gene of phage T4 | Probe | GGGAGTAACACTAATGCAGCAGGGAACCACAGTCACACTTTCTCTTTTGGG |
T4-tail2922 | Tail fiber gene of phage T4 | Probe | TAGCAGTGCTGGCGACCATTCCCACTCTGTAGGTATTGGTGCTCATA |
TABLE 2.
Frequencies of maintenance of phage P1kc and T4GT7 genes in Enterobacteriaceae strainsPhage | Recipient | Result for infection range indicator: | Increase in total no. of cellsc | Increase in phage gene copy no. (SD)d | Maintenance frequency (SD) as determined bye: | ||
---|---|---|---|---|---|---|---|
Plaque formationa | Production of progenyb | Real-time PCR | CPRINS-FISH | ||||
P1kc | C. freundii | − | − | 7.0 × 103 | None | <1.5 × 10−3 | ND |
E. aerogenes | + | + | 1.7 × 103 | 7.7 × 103 (6.5 × 103) | 5.0 × 100 (4.2 × 100) | ND | |
E. coli | + | + | 7.2 × 103 | 5.5 × 103 (2.7 × 103) | 9.1 × 10−1 (0.5 × 10−1) | ND | |
P. mirabilis | − | − | 7.4 × 103 | None | <1.5 × 10−3 | ND | |
S. Enteritidis | − | − | 8.4 × 103 | None | <1.7 × 10−4 | ND | |
Y. enterocolitica | − | − | 4.6 × 103 | None | <1.8 × 10−4 | ND | |
T4GT7 | C. freundii | − | − | 1.5 × 103 | 7.5 × 103 (4.0 × 103) | 8.3 × 10−1 (4.4 × 10−1) | 8.6 × 10−2 (3.4 × 10−2) |
E. aerogenes | + | + | 8.7 × 102 | 1.2 × 103 (0.8 × 103) | 8.0 × 10−1 (5.0 × 10−1) | 4.0 × 10−1 (0.7 × 10−1) | |
E. coli | + | + | 1.1 × 104 | 7.0 × 104 (2.7 × 104) | 8.0 × 101 (3.0 × 10) | 2.1 × 10−1 (0.4 × 10−1) | |
P. mirabilis | − | − | 4.0 × 103 | 5.8 × 103 (4.2 × 103) | 3.3 × 10−1 (2.4 × 10−1) | 3.4 × 10−2 (2.2 × 10−2) | |
S. Enteritidis | − | − | 1.0 × 104 | 7.6 × 101 (5.0 × 101) | 1.0 × 10−2 (0.7 × 10−2) | 8.8 × 10−2 (2.0 × 10−2) | |
Y. enterocolitica | − | − | 3.6 × 103 | 1.6 × 104 (0.4 × 104) | 6.1 × 10−1 (1.6 × 10−1) | 2.2 × 10−2 (2.9 × 10−2) |
17.
18.
Deficient autophagy causes a distinct phenotype in Dictyostelium discoideum, characterized by the formation of multitips at the mound stage. This led us to analyze autophagy in a number of multitipped mutants described previously (tipA−, tipB−, tipC−, and tipD−). We found a clear autophagic dysfunction in tipC− and tipD− while the others showed no defects. tipD codes for a homolog of Atg16, which confirms the role of this protein in Dictyostelium autophagy and validates our approach. The tipC-encoded protein is highly similar to human VPS13A (also known as chorein), whose mutations cause the chorea-acanthocytosis syndrome. No member of the VPS13 protein family has been previously related to autophagy despite the presence of a region of similarity to Atg2 at the C terminus. This region also contains the conserved domain of unknown function DUF1162. Of interest, the expression of the TipC C-terminal coding sequence containing these 2 motifs largely complemented the mutant phenotype. Dictyostelium cells lacking TipC displayed a reduced number of autophagosomes visualized with the markers GFP-Atg18 and GFP-Atg8 and an impaired autophagic degradation as determined by a proteolytic cleavage assay. Downregulation of human VPS13A in HeLa cells by RNA interference confirmed the participation of the human protein in autophagy. VPS13A-depleted cells showed accumulation of autophagic markers and impaired autophagic flux. 相似文献
19.
Lack of repair of ultraviolet light damage in Mycoplasma gallisepticum 总被引:10,自引:0,他引:10
Molecules with single-stranded tails (rolling circles) were isolated as replicating intermediates in G4 progeny single-stranded DNA synthesis. Lysates from infected cells harvested late in infection during single-stranded DNA synthesis were not deproteinised but analysed directly in caesium chloride and propidium diiodide gradients. The gradient fractionated them on the basis of tail length. If the lysates were first deproteinised however, the tailed replicative intermediates banded as a peak at a density just greater than that of replicative form II DNA (RFII) and did not spread down the gradient. The origin of synthesis of the viral strand tail was mapped by electron microscopy as 55 to 60% away from the single EcoRI cleavage site. Termination molecules finishing a round of viral strand DNA synthesis have been identified as molecules consisting of a closed single-stranded DNA circle attached by a very small region to the parent double-stranded DNA circle. 相似文献
20.
High-Frequency Phage-Mediated Gene Transfer among Escherichia coli Cells, Determined at the Single-Cell Level 下载免费PDF全文
Takehiko Kenzaka Katsuji Tani Akiko Sakotani Nobuyasu Yamaguchi Masao Nasu 《Applied microbiology》2007,73(10):3291-3299
Recent whole-genome analysis suggests that lateral gene transfer by bacteriophages has contributed significantly to the genetic diversity of bacteria. To accurately determine the frequency of phage-mediated gene transfer, we employed cycling primed in situ amplification-fluorescent in situ hybridization (CPRINS-FISH) and investigated the movement of the ampicillin resistance gene among Escherichia coli cells mediated by phage at the single-cell level. Phages P1 and T4 and the newly isolated E. coli phage EC10 were used as vectors. The transduction frequencies determined by conventional plating were 3 × 10−8 to 2 × 10−6, 1 × 10−8 to 4 × 10−8, and <4 × 10−9 to 4 × 10−8 per PFU for phages P1, T4, and EC10, respectively. The frequencies of DNA transfer determined by CPRINS-FISH were 7 × 10−4 to 1 × 10−3, 9 × 10−4 to 3 × 10−3, and 5 × 10−4 to 4 × 10−3 for phages P1, T4, and EC10, respectively. Direct viable counting combined with CPRINS-FISH revealed that more than 20% of the cells carrying the transferred gene retained their viabilities. These results revealed that the difference in the number of viable cells carrying the transferred gene and the number of cells capable of growth on the selective medium was 3 to 4 orders of magnitude, indicating that phage-mediated exchange of DNA sequences among bacteria occurs with unexpectedly high frequency. 相似文献