Over-expression of BcFLC1 from non-heading Chinese cabbage enhances cold tolerance in Arabidopsis

A gene (named BcFLC1) homologous to the AtFLC gene, which encodes a floral repressor, was isolated from the nonheading Chinese cabbage (Brassica campestris L. ssp. chinensis) cv. NJ074. The gene showed high similarity to AtFLC. For studying the gene function, we designed to introduce the BcFLC1 gene into Arabidopsis thaliana. The results showed that BcFLC1 had effects on flowering time similar to AtFLC. We also found that Arabidopsis cold-tolerance was enhanced by BcFLC1 overexpression. Under low temperature stress, the BcFLC1 transgenic plants exhibited stronger growth than wild-type plants. The elevated cold tolerance of the BcFLC1 over-expressing plants was also confirmed by the changes of electrolyte leakage and malonyldialdehyde and proline content.     

Diversity and evolution of Pong-like elements in Bambusoideae subfamily

The PIF/IS5 is a recently discovered superfamily of DNA transposons which include Pong-like elements and PIF-like elements and has been successively detected in the genomes of many flowering plants, fungi and diverse animals. Here we present the first comprehensive characterization and analysis of Pong-like elements in Bambusoideae subfamily. Eighty-two Pong-like elements were cloned and sequenced from 44 representative species of Bambusoideae. Phylogenetic analysis of 82 distinct Pong-like elements sequences showed that Pong-like elements were widespread, diverse and abundant in Bambusoideae. A molecular phylogeny of Bambusoideae was established by using the internal transcribed spacer sequence of nuclear ribosomal DNA (ITS) information. The comparison between ITS and Pong-like elements based trees reveals obviously incongruent. The results suggest that 1) there are multiple Pong-like element families in Bambusoideae; 2) a single Pong-like element family could be present in multiple bamboo species; 3) Pong-like elements from the same family from different bamboo species could be more similar than elements from different families in the same bamboo species or closely related species.     

Profiling of RNA ribose methylation in Arabidopsis thaliana

Eukaryotic rRNAs and snRNAs are decorated with abundant 2′-O-methylated nucleotides (Nm) that are predominantly synthesized by box C/D snoRNA-guided enzymes. In the model plant Arabidopsis thaliana, C/D snoRNAs have been well categorized, but there is a lack of systematic mapping of Nm. Here, we applied RiboMeth-seq to profile Nm in cytoplasmic, chloroplast and mitochondrial rRNAs and snRNAs. We identified 111 Nm in cytoplasmic rRNAs and 19 Nm in snRNAs and assigned guide for majority of the detected sites using an updated snoRNA list. At least four sites are directed by guides with multiple specificities as shown in yeast. We found that C/D snoRNAs frequently form extra pairs with nearby sequences of methylation sites, potentially facilitating the substrate binding. Chloroplast and mitochondrial rRNAs contain five almost identical methylation sites, including two novel sites mediating ribosomal subunit joining. Deletion of FIB1 or FIB2 gene reduced the accumulation of C/D snoRNA and rRNA methylation with FIB1 playing a bigger role in methylation. Our data reveal the comprehensive 2′-O-methylation maps for Arabidopsis rRNAs and snRNAs and would facilitate study of their function and biosynthesis.     

Expression of Arabidopsis thaliana xylose isomerase gene and its effect on ethanol production in Flammulina velutipes

To improve the pentose fermentation rate in Flammulina velutipes, the putative xylose isomerase (XI) gene from Arabidopsis thaliana was cloned and introduced into F. velutipes and the gene expression was evaluated in transformants. mRNA expression of the putative XI gene and XI activity were observed in two transformants, indicating that the putative gene from A. thaliana was successfully expressed in F. velutipes as a xylose isomerase. In addition, ethanol production from xylose was increased in the recombinant strains. This is the first report demonstrating the possibility of using plant genes as candidates for improving the characteristics of F. velutipes.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Visualization of site-specific recombination catalyzed by a recombinase from Zygosaccharomyces rouxii in Arabidopsis thaliana

Excision of a DNA segment can occur in Arabidopsis thaliana by reciprocal recombination between two specific recombination sites (RSs) when the recombinase gene (R) from Zygosaccharomyces rouxii is expressed in the plant. To monitor recombination events, we generated several lines of transgenic Arabidopsis plants that carried a cryptic β-glucuronidase (GUS) reporter gene which was designed in such a way that expression of the reporter gene could be induced by R gene-mediated recombination. We also made several transgenic lines with an R gene linked to the 35S promoter of cauliflower mosaic virus. Each transgenic line carrying the cryptic reporter gene was crossed with each line carrying the R gene. Activity of GUS in F₁ and F₂ progeny was examined histochemically and recombination between two RSs was analyzed by Southern blotting and the polymerase chain reaction. In seedlings and plantlets of F₁ progeny and most of the F₂ progeny, a variety of patterns of activity of GUS, including sectorial chimerism in leaves, was observed. A small percentage of F₂ individuals exhibited GUS activity in the entire plant. This pattern of expression was ascribed to germinal recombination in the F₁ generation on the basis of an analysis of DNA structure by Southern blotting. These results indicate that R gene-mediated recombination can be induced in both somatic and germ cells of A. thaliana by cross-pollination of parental transgenic lines.     

Characterization of Repetitive DNA Elements in Arabidopsis

We have applied computational methods to the available database and identified several families of repetitive DNA elements in the Arabidopsis thaliana genome. While some of the elements have features expected of either miniature inverted-repeat transposable elements (MITEs) or retrotransposons, the most abundant class of repetitive elements, the AthE1 family, is structurally related to neither. The AthE1 family members are defined by conserved 5′ and 3′ sequences, but these terminal sequences do not represent either inverted or direct repeats. AthE1 family members with greater than 98% identity are easily identified on different Arabidopsis chromosomes. Similar to nonautonomous DNA-based transposon families, the AthE1 family contains members in which the conserved terminal domains flank unrelated sequences. The primary utility of characterizing repetitive sequences is in defining, at least in part, the evolutionary architecture of specific Arabidopsis loci. The repetitive elements described here make up approximately 1% of the available Arabidopsis thaliana genomic sequence. Received: 13 October 1998 / Accepted: 30 December 1998     

A Phosphoribosylanthranilate Transferase Gene Is Defective in Blue Fluorescent Arabidopsis thaliana Tryptophan Mutants

An Arabidopsis thaliana gene encoding phosphoribosylanthranilate transferase is shown to be the gene that is defective in blue fluorescent trp1 mutant plants. This gene, named PAT1, was isolated using an A. thaliana cDNA clone that suppressed an Escherichia coli trpD⁻ mutation. The PAT1 coding region is homologous to those for the phosphoribosylanthranilate transferases from many microorganisms. Unlike other genes involved in aromatic amino acid biosynthesis in A. thaliana, PAT1 appears to be a single-copy gene. PAT1 was demonstrated to be the gene that is defective in blue fluorescent trp1 mutants by two methods: genetic complementation in transgenic plants and genetic mapping studies. This is the first report of cloning a plant phosphoribosylanthranilate transferase gene. The PAT1 gene should prove useful as a selectable marker for transformation or a visible reporter of gene expression when used in conjunction with trp1 plants.     

Tetralocular ovary and high silique width in yellow sarson lines of Brassica rapa (subspecies trilocularis) are due to a mutation in Bra034340 gene,a homologue of CLAVATA3 in Arabidopsis

Key message

Genetic locus for tetralocular ovary ( tet - o ) in Brassica rapa was identified and it was shown that the number of locules and width of silique are associated.

Abstract

Brassica rapa is a highly polymorphic species containing many vegetables and oleiferous types. An interesting group of oleiferous types is the yellow sarson group (subspecies trilocularis) grown mostly in eastern India. This group contains lines that have bilocular ovaries, a defining trait of Brassicaceae, but also lines that have tetralocular ovaries. Yellow sarson lines commonly have high silique width which is further enhanced in the tetralocular types. We mapped the locus influencing tetralocular ovary in B. rapa using three mapping populations (F₂, F₆ and F₇) derived from a cross between Chiifu (subspecies pekinensis, having bilocular ovary) and Tetralocular (having tetralocular ovary). QTL mapping of silique width was undertaken using the three mapping populations and a F₂ population derived from a cross between Chiifu and YSPB-24 (a bilocular line belonging to yellow sarson group). Qualitative mapping of the trait governing locule number (tet-o) in B. rapa mapped the locus to linkage group A4. QTL mapping for silique width detected a major QTL on LG A4, co-mapping with the tet-o locus in bilocular/tetralocular cross. This QTL was not detected in the bilocular/bilocular cross. Saturation mapping of the tet-o region with SNP markers identified Bra034340, a homologue of CLAVATA3 of Arabidopsis thaliana, as the candidate gene for locule number. A C → T transition at position 176 of the coding sequence of Bra034340 revealed co-segregation with the tetralocular phenotype. The study of silique related traits is of interest both for understanding evolution under artificial selection and for breeding of cultivated Brassica species.     

Characterization of the first tuber mustard calmodulin-like gene, BjAAR1, and its functions in responses to abiotic stress and abscisic acid in Arabidopsis

The first tuber mustard calmodulin-like (CML) gene BjAAR1 (Brassica juncea var. tumida Tsen et Lee Abiotic stress and Abscisic acid (ABA) Responsive gene 1) was cloned and characterized. The protein encoded by BjAAR1 contains four predicted Ca²⁺ binding sites (EF-hand motif) and its recombinant protein can bind Ca²⁺ in vitro. qRT-PCR showed that the expression level of BjAAR1 was rather high in non-swollen stem of tuber mustard and largely reduced in swollen stem. Expression of BjAAR1 enhanced ABA- and stress-induced gene expression in Arabidopsis (Arabidopsis thaliana). Transgenic plants also exhibited hypersensitivity to NaCl, mannitol, and ABA during the seed germination and post-germination stages. ABA biosynthesis inhibitor, norflurazon (NF), rescued hypersensitivity phenotype of transgenic plants to NaCl and mannitol, indicating that BjAAR1 functions in multiple abiotic stresses response through ABA-dependent process.     

Phosphatidylglycerophosphate phosphatase is required for root growth in Arabidopsis

Phosphatidylglycerol (PG) is an indispensable lipid class in photosynthetic activity. However, the importance of PG biosynthesis in non-photosynthetic organs remains elusive. We previously identified phosphatidylglycerophosphate phosphatase 1 (PGPP1), which catalyzes the last step of PG biosynthesis in Arabidopsis thaliana. In the present report, we noted considerably shorter roots of the pgpp1-1 mutant compared to the wild type. We observed defective order of columella cells in the root apices, which was complemented by introducing the wild-type PGPP1 gene. Although PGPP1 is chloroplast-localized in leaf mesophyll cells, we observed mitochondrial localization of PGPP1 in root cells, suggesting possible dual targeting of PGPP1. Moreover, we identified previously uncharacterized 2 protein tyrosine phosphatase-like proteins as functional PGPPs. These proteins, designated PTPMT1 and PTPMT2, complemented growth and lipid phenotypes of Δgep4, a Saccharomyces cerevisiae mutant of PGPP. The ptpmt1-1 ptpmt2-1 exhibited no visible phenotype; however, the pgpp1-1 ptpmt1-1 ptpmt2-1 significantly enhanced the root phenotype of pgpp1-1 without further affecting the photosynthesis, suggesting that these newly found PGPPs are involved in the root phenotype. Radiolabeling experiment of mutant roots showed that decreased PG biosynthesis is associated with the mutation of PGPP1. These results suggest that PG biosynthesis is required for the root growth.     

Cloning and Characterization of an Arabidopsis thaliana Topoisomerase I Gene

cDNA and genomic clones encoding DNA topoisomerase I were isolated from Arabidopsis thaliana λgt11 and λFix libraries by low stringency hybridization with a Saccharomyces cerevisiae TOP1 probe. The cDNA clones include a 2748-base pair open reading frame predicting an amino acid sequence that is highly homologous to sequences encoded by TOP1 from yeast and human sources. The sequence of the upstream genomic region reveals two putative TATA-like elements and a purine-rich region, but no other obvious controlling elements. Southern blot analysis shows that the gene is present as a single copy in the Arabidopsis genome. When expressed in a S. cerevisiae top1 mutant under the control of the GAL1 promoter, the gene complements the phenotype caused by loss of topoisomerase activity and directs the expression of a protein that cross-reacts with a human anti-topoisomerase I antibody.     

Molecular mapping of a male fertility restorer locus of Brassica oleracea using expressed sequence tag-based single nucleotide polymorphism markers and analysis of a syntenic region in Arabidopsis thaliana for identification of genes encoding pentatricopeptide repeat proteins

An F₂ population was developed from a cross between a mur-cytoplasmic male sterile broccoli line and a restorer Chinese kale line. Phenotypic analysis of F₂ plants indicated that the pollen fertility is controlled by two genes and segregated in a duplicate gene interaction mode with a ratio of 15:1. A total of 236 single nucleotide polymorphism (SNP) markers were developed utilizing 1,448 primers designed for production of expressed sequence tag (EST)-SNP markers of Raphanus sativus and analyzed by the dot-blot technique in 205 F₂ individuals. A linkage map was constructed with a total of 142 markers and these markers were assigned to nine linkage groups together with simple sequence repeat markers mapped previously on the published linkage maps of Brassica oleracea. The linkage map spanned 909 cM with an average marker distance of 6.4 cM. A fertility restorer locus (Rfm1) was mapped on LG1, corresponding to chromosome 3, along with a flower color locus at a distance of 25 cM. SNP markers flanking the Rfm1 locus were BoCL2642s at a distance of 2.5 cM on one side and BoCL2901s at a distance of 7.5 cM on the other side. All the SNP markers showed homology with Arabidopsis thaliana and Brassica rapa genome sequences. Three pentatricopeptide repeat genes of the P-subfamily, particularly expressed in buds of the restorer line, were identified and these genes could be potential candidate fertility restorer genes.     

Functional analysis of the Hikeshi-like protein and its interaction with HSP70 in Arabidopsis

Heat shock proteins (HSPs) refold damaged proteins and are an essential component of the heat shock response. Previously, the 70 kDa heat shock protein (HSP70) has been reported to translocate into the nucleus in a heat-dependent manner in many organisms. In humans, the heat-induced translocation of HSP70 requires the nuclear carrier protein Hikeshi. In the Arabidopsis genome, only one gene encodes a protein with high homology to Hikeshi, and we named this homolog Hikeshi-like (HKL) protein. In this study, we show that two Arabidopsis HSP70 isoforms accumulate in the nucleus in response to heat shock and that HKL interacts with these HSP70s. Our histochemical analysis revealed that HKL is predominantly expressed in meristematic tissues, suggesting the potential importance of HKL during cell division in Arabidopsis. In addition, we show that HKL regulates HSP70 localization, and HKL overexpression conferred thermotolerance to transgenic Arabidopsis plants. Our results suggest that HKL plays a positive role in the thermotolerance of Arabidopsis plants and cooperatively interacts with HSP70.     

Nucleotide sequence of a gene from Arabidopsis thaliana encoding a myb homologue

A gene encoding a proto-oncogene, a myb-related gene named Atmyb1, was cloned from Arabidopsis thaliana, and its nucleotide sequence was determined. The Atmyb1 gene contains an intron of 494 bp, and there are no highly homologous sequences present in the A. thaliana genome, but evidence was found that other myb-related genes exist. In the 5 flanking region, we found several typical cis-acting elements found in plant promoters. Sequence comparisons revealed that the ATMYB1 protein has a putative DNA-binding domain with two repeats of tryptophan clusters, which is common in MYB-related proteins in plants, while animal MYB-related proteins contain DNA-binding domains with three repeats of tryptophan clusters. The putative DNA-binding domain of the ATMYB1 protein has higher homology with that of the human c-MYB protein than with those of other plant MYB proteins.     

Unexpectedly rapid IS1 transposition into an Arabidopsis chromatin remodeling gene

Common cloning is often associated with instability of certain classes of DNA. Here we report on IS1 transposition as possible source of such instability. During the cloning of Arabidopsis thaliana gene into commercially available vector maintained in widely used Escherichia coli host the insertion of complete IS1 element into the intron of cloned gene was found. The transposition of the IS1 element was remarkably rapid and is likely to be sequence-specific. The use of E. coli strains that lower the copy number of vector or avoiding the presence of the problematic sequence is a solution to the inadvertent transposition of IS1. The transposition of IS1 is rare but it can occur and might confound functional studies of a plant gene.     

BASIC PENTACYSTEINE1, a GA binding protein that induces conformational changes in the regulatory region of the homeotic Arabidopsis gene SEEDSTICK

The mechanisms for the regulation of homeotic genes are poorly understood in most organisms, including plants. We identified BASIC PENTACYSTEINE1 (BPC1) as a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity, and characterized its mechanism of action. A combination of tethered particle motion analysis and electromobility shift assays revealed that BPC1 is able to induce conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. Analysis of STK expression in the bpc1 mutant showed that STK is upregulated. Our results give insight into the regulation of gene expression in plants and provide the basis for further studies to understand the mechanisms that control ovule identity in Arabidopsis.