Bacterial artificial chromosome library for genome‐wide analysis of Chinese hamster ovary cells

Chinese hamster ovary (CHO) cell lines are widely used for scientific research and biotechnology. A CHO genomic bacterial artificial chromosome (BAC) library was constructed from a mouse dihydrofolate reductase (DHFR) gene‐amplified CHO DR1000L‐4N cell line for genome‐wide analysis of CHO cell lines. The CHO BAC library consisted of 122,281 clones and was expected to cover the entire CHO genome five times. A CHO chromosomal map was constructed by fluorescence in situ hybridization (FISH) imaging using BAC clones as hybridization probes (BAC‐FISH). Thirteen BAC‐FISH marker clones were necessary to identify all the 20 individual chromosomes in a DHFR‐deficient CHO DG44 cell line because of the aneuploidy of the cell line. To determine the genomic structure of the exogenous Dhfr amplicon, a 165‐kb DNA region containing exogenous Dhfr was cloned from the BAC library using high‐density replica (HDR) filters and Southern blot analysis. The nucleotide sequence analysis revealed a novel genomic structure in which the vector sequence containing Dhfr was sandwiched by long inverted sequences of the CHO genome. Biotechnol. Bioeng. 2009; 104: 986–994. © 2009 Wiley Periodicals, Inc.     

Fusion of the Dhfr/Mtx and IR/MAR Gene Amplification Methods Produces a Rapid and Efficient Method for Stable Recombinant Protein Production

Amplification of the dihydrofolate reductase gene (Dhfr) by methotrexate (Mtx) exposure is commonly used for recombinant protein expression in Chinese hamster ovary (CHO) cells. However, this method is both time- and labor-intensive, and the high-producing cells that are generated are frequently unstable in culture. Another gene amplification method is based on using a plasmid bearing a mammalian replication initiation region (IR) and a matrix attachment region (MAR), which result in the spontaneous initiation of gene amplification in transfected cells. The IR/MAR and Dhfr/Mtx methods of gene amplification are based on entirely different principles. In this study, we combine these two methods to yield a novel method, termed the IR/MAR-Dhfr fusion method, which was used to express three proteins, the Fc receptor, GFP, and recombinant antibody. The fusion method resulted in a dramatic increase in expression of all three proteins in two CHO sub-lines, DXB-11, and DG44. The IR/MAR-Dhfr fusion amplified the genes rapidly and efficiently, and produced larger amounts of antibody than the Dhfr/Mtx or IR/MAR methods alone. While the amplified structure produced by the Dhfr/Mtx method was highly unstable, and the antibody production rate rapidly decreased with the culture time of the cells, the IR/MAR-Dhfr fusion method resulted in stable amplification and generated clonal cells that produced large amounts of antibody protein over a long period of time. In summary, the novel IR/MAR-Dhfr fusion method enables isolation of stable cells that produce larger amounts of a target recombinant protein more rapidly and easily than either the Dhfr/Mtx or IR/MAR methods alone.     

How a Replication Origin and Matrix Attachment Region Accelerate Gene Amplification under Replication Stress in Mammalian Cells

The gene amplification plays a critical role in the malignant transformation of mammalian cells. The most widespread method for amplifying a target gene in cell culture is the use of methotrexate (Mtx) treatment to amplify dihydrofolate reductase (Dhfr). Whereas, we found that a plasmid bearing both a mammalian origin of replication (initiation region; IR) and a matrix attachment region (MAR) was spontaneously amplified in mammalian cells. In this study, we attempted to uncover the underlying mechanism by which the IR/MAR sequence might accelerate Mtx induced Dhfr amplification. The plasmid containing the IR/MAR was extrachromosomally amplified, and then integrated at multiple chromosomal locations within individual cells, increasing the likelihood that the plasmid might be inserted into a chromosomal environment that permits high expression and further amplification. Efficient amplification of this plasmid alleviated the genotoxicity of Mtx. Clone-based cytogenetic and sequence analysis revealed that the plasmid was amplified in a chromosomal context by breakage-fusion-bridge cycles operating either at the plasmid repeat or at the flanking fragile site activated by Mtx. This mechanism explains how a circular molecule bearing IR/MAR sequences of chromosomal origin might be amplified under replication stress, and also provides insight into gene amplification in human cancer.     

Selection for methotrexate resistance in mammalian cells bearing a <Emphasis Type="Italic">Drosophila</Emphasis> dihydrofolate reductase transgene

Antifolates, such as methotrexate (MTX), are the treatment of choice for numerous cancers. MTX inhibits dihydrofolate reductase (DHFR), which is essential for cell growth and proliferation. Mammalian cells can acquire resistance to antifolate treatment through a variety of mechanisms but decreased antifolate titers due to changes in drug efflux or influx, or alternatively, the amplification of the DHFR gene are the most commonly acquired resistance mechanisms. In Drosophila, however, a resistant phenotype has only been observed to occur by mutation resulting in a MTX-resistant DHFR. It is unclear if differences in gene structure and/or genome organization between Drosophila and mammals contribute to the observed differences in acquired drug resistance. To investigate if gene structure is involved, Drosophila Dhfr cDNA was transfected into a line of CHO cells that do not express endogenous DHFR. These transgenic cells, together with wild-type CHO cells, were selected for 19 months for resistance to increasing concentrations of MTX, from 50- to 200-fold over the initial concentration. Since Drosophila Dhfr appears to have been amplified several fold in the selected transgenic mammalian cells, a difference in genome organization may contribute to the mechanism of MTX resistance.     

Identification of regulatory motifs in the CHO genome for stable monoclonal antibody production

Chinese hamster ovary (CHO) cell lines are widely used for therapeutic protein production. When a transgene is integrated into the genome of a CHO cell, the expression level is highly dependent on the site of integration because of positional effects such as gene silencing. To overcome negative positional effects and establish stable CHO cell lines with high productivity, several regulatory DNA elements are used in vector construction. Previously, we established the CHO DR1000L-4N cell line, a stable and high copy number Dhfr gene-amplified cell line. It was hypothesized that the chromosomal location of the exogenous gene-amplified region in the CHO DR1000L-4N genome contains regulatory motifs for stable protein production. Therefore, we isolated DNA regulatory motifs from the CHO DR1000L-4N cell line and determined whether these motifs act as an insulator. Our results suggest that stable expression of a transgene can be promoted by the CHO genome sequence, and it would be a powerful tool for therapeutic protein manufacturing.     

BACFinder: genomic localisation of large insert genomic clones based on restriction fingerprinting

We have developed software that allows the prediction of the genomic location of a bacterial artificial chromosome (BAC) clone, or other large genomic clone, based on a simple restriction digest of the BAC. The mapping is performed by comparing the experimentally derived restriction digest of the BAC DNA with a virtual restriction digest of the whole genome sequence. Our trials indicate that this program identified the genomic regions represented by BAC clones with a degree of accuracy comparable to that of end-sequencing, but at considerably less cost. Although the program has been developed principally for use with Arabidopsis BACs, it should align large insert genomic clones to any fully sequenced genome.     

Construction of a bacterial artificial chromosome library for the Rongchang pig breed and its use for the identification of genes involved in intramuscular fat deposition

In a search for genes affecting intramuscular fat deposition, we constructed a bacterial artificial chromosome (BAC) library for the whole genome of Rongchang pig, a domestic Chinese swine breed. The library consisted of approximately 192,000 clones, with an averaged insert size of 116 kb. Frequency of non-insert clone of the BAC library was no higher than 1.8%, based on estimation of 220 BAC clones randomly selected. We estimated the coverage of the library to be more than seven porcine genome equivalents. Subsequent screening of the BAC library with a three-step PCR procedure resulted in identification of seven candidate genes that were potentially involved in intramuscular fat deposition. The number of positive BAC clones ranged from 2 to 4 for each of the seven genes. One positive clone, containing the lipin1 gene, was fully sequenced by shotgun method to generate 118,041 bp porcine genomic sequences. The BAC clone contained complete DNA sequence of porcine lipin1 gene including all the exons and introns. Our results indicate that this BAC library is a useful tool for gene identification and help to serve as an important resource for future porcine genomic study.     

A Hybrid System Using Both Promoter Activation and Gene Amplification for Establishing Exogenous Protein Hyper-Producing Cell Lines

We previously developed a promoter-activated production (PAP) system using amplified ras oncogene to activate the cytomegalovirus (CMV) promoter controlling the foreign gene in mammalian cells. CHO cells were demonstrated to be suitable for the PAP system. Here, we show that very high-level production of a recombinant protein was achieved when the human CMV promoter was inserted into a glutamine synthetase (GS) minigene expression plasmid, pEE14. A highly productive host CHO cell line, ras clone I containing amplified ras oncogene, was further transfected with the plasmid expressing both hIL-6 gene and GS minigene, and selected with methionine sulphoximine. We were able to establish a hIL-6 hyper-producing cell line, D29, which exhibited a peak productivity rate of approximately 40 μg hIL-6 10^?6 cells day^?1 through a combination of the PAP system and the GS gene amplification system. The cellular productivity of D29 cells was about 13-fold higher than control hIL-6-producing cells derived from CHO cells whose hIL-6 gene was amplified by the GS gene amplification system, and about 5-fold higher than the I13 cells established by the PAP system, which contains amplified ras oncogene and non-amplified hIL-6 gene. When D29 cells were cultured for a month, an accumulation rate of approximately 80 μg hIL-6 ml^?1 per 3 days was achieved on the 9th day. These results indicate that this PAP and GS hybrid system enables the efficient and rapid establishment of recombinant protein hyper-producing cell lines.     

Physical mapping of unique nucleotide sequences on identified rice chromosomes

A physical mapping method for unique nucleotide sequences on specific chromosomal regions was developed combining objective chromosome identification and highly sensitive fluorescence in situ hybridisation (FISH). Four unique nucleotide sequences cloned from rice genomic DNAs, varying in size from 1.3 to 400 kb, were mapped on a rice chromosome map. A yeast artificial chromosome (YAC) clone with a 399 kb insert of rice genomic DNA was localised at the distal end of the long arm of rice chromosome (1q2.1) and a bacterial artificial chromosome (BAC) clone (180 kb) containing the rice leaf blast-resistant gene (Pi-b) was shown to occur at the distal end of the long arm of chromosome 2 (2q2.1). A cosmid (35 kb) with the resistance gene (Xa-21) against bacterial leaf blight was mapped on the interstitial region of the long arm on chromosome 11 (11q1.3). Furthermore a single RFLP marker, 1.29 kb in size, was mapped successfully to the distal region of the long arm of rice chromosome 4 (4q2.1). For precise localisation of the nucleotide sequences within the chromosome region, image analyses were effective. The BAC clone was localised to the specific region, 2q2.1:96.16, by image analysis. The result was compared with the known location of the BAC clone on the genetic map and the consistency was confirmed. The effectiveness and reliability in physically mapping nucleotide sequences on small plant chromosomes achieved by the FISH method using a variety of probes was unequivocally demonstrated.     

DNA modification and functional delivery into human cells using Escherichia coli DH10B

The availability of almost the complete human genome as cloned BAC libraries represents a valuable resource for functional genomic analysis, which, however, has been somewhat limited by the ability to modify and transfer this DNA into mammalian cells intact. Here we report a novel comprehensive Escherichia coli-based vector system for the modification, propagation and delivery of large human genomic BAC clones into mammalian cells. The GET recombination inducible homologous recombination system was used in the BAC host strain E.coli DH10B to precisely insert an EGFPneo cassette into the vector portion of a ~200 kb human BAC clone, providing a relatively simple method to directly convert available BAC clones into suitable vectors for mammalian cells. GET recombination was also used for the targeted deletion of the asd gene from the E.coli chromosome, resulting in defective cell wall synthesis and diaminopimelic acid auxotrophy. Transfer of the Yersinia pseudotuberculosis invasin gene into E.coli DH10B asd^– rendered it competent to invade HeLa cells and deliver DNA, as judged by transient expression of green fluorescent protein and stable neomycin-resistant colonies. The efficiency of DNA transfer and survival of HeLa cells has been optimized for incubation time and multiplicity of infection of invasive E.coli with HeLa cells. This combination of E.coli-based homologous recombination and invasion technologies using BAC host strain E.coli DH10B will greatly improve the utility of the available BAC libraries from the human and other genomes for gene expression and functional genomic studies.     

Genomic studies of gene expression: regulation of the Wilson disease gene

Bacterial artificial chromosomes (BACs) have many advantages over other large-insert cloning vectors and have been used for a variety of genetic applications, including the final contigs of the human genome. We describe the utilization of a BAC construct to study gene regulation in a tissue culture-based system, using a 170-kb clone containing the entire Wilson disease (WND) locus as a model. A second BAC construct that lacked a putative negatively regulating promoter sequence was created. A nonviral method of gene delivery was applied to transfect three human cell lines stably with each construct. Our results show correct WND gene expression from the recombinant locus and quantification revealed significantly increased expression from the clone lacking the negative regulator. Comparison with conventional methods confirms the reliability of the genomic approach for thorough examination of gene expression. This experimental system illustrates the potential of BAC clones in genomic gene expression studies, new gene therapy strategies, and validation of potential molecular targets for drug discovery.     

Sequences of the Epstein-Barr Virus (EBV) large internal repeat form the center of a 16-kilobase-pair palindrome of EBV (P3HR-1) heterogeneous DNA.

We have previously characterized several genomic rearrangements of Epstein-Barr virus (EBV) DNA contained in one of the defective EBV genomes harbored by the P3HR-1 (HR-1) line (H. B. Jenson, M. S. Rabson, and G. Miller, J. Virol. 58:475-486, 1986). One recombinant clone of heterogeneous DNA (het DNA) from this defective genome is an EcoRI fragment of 16 kilobase pairs (kbp) which is a palindrome. DNA digestion fragments specific for the center of this palindrome were present in cells which contained het DNA but not in cells which lacked het DNA. Thus, the palindrome was not an artifact of DNA cloning. The organization of the center of this palindrome was studied by DNA sequencing. The comparable region of the parental HR-1 genome was also studied by DNA sequencing. The central 3,495 base pairs (bp) of the palindrome were composed of sequences derived exclusively from internal repeat 1 of EBV, represented by BamHI W fragment. At each end of the central 3,495 hp was a symmetrical recombination with sequences of BamHI-Z, located more than 50 kbp away on the standard EBV genome. The central 3,495 bp were composed of an unduplicated 341 bp flanked by two perfect palindromic repeats of 1,577 bp. The 341-bp unique region was a portion of a 387-bp region of standard HR-1 BamHI-W which was identical to the central 387 bp of the palindrome. This central 387-bp region contained numerous stretches of dyad symmetry capable of forming a large stem-and-loop structure. The palindromic rearrangement had created two novel open reading frames in het DNA derived from standard HR-1 BamHI-W sequences. These two het DNA open reading frames had different amino termini but identical carboxy termini derived from the large open reading frame in standard HR-1 BamHI-W (HR-1 BWRF1). The BamHI-W sequences found in het DNA did not include either the TATA box of standard HR-1 BamHI-W or the exons which are present in the potentially polycistronic latent mRNAs encoding EBV nuclear antigens. These marked alterations in genomic structure may relate to the unique biologic properties of virus stocks containing het DNA by creation of new polypeptides or by formation or deletion of regulatory or functional signals.     

HCV core protein-expressing DNA vaccine induces a strong class I-binding peptide DTH response in mice

In previous studies, we developed mouse genetic models and discovered genetic components of quantitative trait loci on mouse chromosomes that contribute to phenotypes such as bone size, bone density, and fracture healing. However, these regions contain dozens of genes in several overlapping bacterial artificial chromosomes (BACs) and are difficult to clone by physical cloning strategies. A feasible and efficient approach of identifying candidate genes is to transfer the genomic loci in BAC clones into mammalian cells for functional studies. In this study, we retrofitted a BAC construct into herpes simplex virus-1 amplicon and packaged it into an infectious BAC (iBAC) to test gene function in a cell-based system, using a 128-kb clone containing the complete bone morphogenetic protein-2 (BMP-2) gene. We transduced MC3T3-E1 cells with the iBAC bearing BMP-2 gene and examined transgene expression and function. Our results have demonstrated that an iBAC can efficiently deliver a BMP-2 genomic locus into preosteoblast cells and express functional BMP-2 protein, inducing a phenotype of cell differentiation, as indicated by an increase in alkaline phosphatase activity. Therefore, this experimental system provides a rapid, efficient cell-based model of high-throughput phenotypic screening to identify the BAC clones from physically mapped regions that are important for osteoblast differentiation. It also illustrates the potential of iBAC technology in functional testing of single nucleotide polymorphisms located in the distal promoter or/and intron regions responsible for low bone density.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Identification and analysis of a third mouse Polycomb gene, MPc3

Betaine-homocysteine S-methyltransferase (BHMT) is one of the enzymes involved in the branch point metabolism of homocysteine. Elevated levels of plasma homocysteine may be a risk factor for the development of vascular disease; however, whether BHMT has a significant role in the regulation of plasma levels of homocysteine remains to be determined. As a prelude to creating a mouse strain deficient in BHMT activity, we screened a lambda library containing mouse SvJ 129 genomic DNA for the mouse BHMT gene using random probes made from the human cDNA. One genomic isolate was completely sequenced and found to encode an intronless BHMT pseudogene (mBHMT-ps). mBHMT-ps was then used as a template for the generation of random probes that were used to screen a BAC library containing mouse 129 Sv/Ev genomic DNA. In order to discriminate between pseudogenes and the authentic BHMT gene, a secondary PCR-based screen was employed which used primers designed from the pseudogene sequence that would predictably amplify across introns. Using this strategy, we isolated six mouse genomic clones that tested positive for the presence of all seven introns characteristic of the human gene, and the BHMT gene of one clone was completely sequenced. Like the human BHMT gene, the mouse gene spans 21 kb and is encoded by eight exons interrupted by seven introns. The structure of the mouse BHMT gene is described herein as well as the 5′-flanking region of the gene adjacent to exon 1, which we demonstrate is capable of conferring basal promoter activity in Chinese Hamster Ovary cells.     

A general method to modify BACs to generate large recombinant DNA fragments

Bacterial artificial chromosome (BAC) has the capacity to clone DNA fragments in excess of 300 kb. It also has the considerable advantages of stable propagation and ease of purification. These features make BAC suitable in genetic research, such as library construction, transgenic mice production, and gene targeting constructs. Homologous recombination in Escherichia coli, a process named recombineering, has made the modification of BACs easy and reliable. We report here a modified recombineering method that can efficiently mediate the fusion of large DNA fragments from two or more different BACs. With the introduction of kanamycin-resistant gene and proposed rare-cutting restriction endonuclease (RCRE) sites into two BACs, a 82.6-kb DNA frament containing the inverted human α-globin genes (ϑ, α1, α2, and ζ) from BAC191K2 and the locus control region (LCR) of human β-globin gene locus (from the BAC186D7) was reconstructed. This approach for combining different BAC DNA fragments should facilitate many kinds of genomic experiments. These two authors contributed equally to this work.