Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG)(n) might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG)(n) are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482) and unimolecular quadruplex telomeric DNA-binding protein 25 (uqTBP25) (Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 15881-15890). Blunt-ended and 3'-tailed or 3'- and 5'-tailed bimolecular tetraplex structures of d(CGG)(n) and guanine-sparse 20-/46-mer partial DNA duplex were progressively destabilized by increasing amounts of qTBP42 or uqTBP25 in time-dependent and ATP- or Mg(2+)-independent reactions. By contrast, tetraplex structures of telomeric and IgG sequences or guanine-rich double-stranded DNA resisted destabilization by qTBP42 or uqTBP25. Increased stability of tetraplex d(CGG)(n) in the presence of K(+) or Na(+) ions or at lowered reaction temperature diminished the destabilizing activity of uqTBP25. The contrasting stabilization of tetraplex telomeric DNA and destabilization of tetraplex d(CGG)(n) by qTBP42 and uqTBP25 suggested that sequence or structural differences between these tetraplexes might serve as cues for the differential stabilizing/destabilizing activities.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical structures

Fragile X syndrome is caused by expansion of a d(CGG) trinucleotide repeat sequence in the 5′ untranslated region of the first exon of the FMR1 gene. Repeat expansion is thought to be instigated by formation of d(CGG)_n secondary structures. Stable FMR1 d(CGG)_n runs in normal individuals consist of 6–52 d(CGG) repeats that are interrupted every 9–11 triplets by a single d(AGG) trinucleotide. By contrast, individuals having fragile X syndrome premutation or full mutation present >54–200 or >200–2000 monotonous d(CGG) repeats, respectively. Here we show that the presence of interspersed d(AGG) triplets diminished in vitro formation of bimolecular tetrahelical structures of d(CGG)₁₈ oligomers. Tetraplex structures formed by d(CGG)_n oligomers containing d(AGG) interspersions had lower thermal stability. In addition, tetraplex structures of d(CGG)₁₈ oligomers interspersed by d(AGG) triplets were unwound by human Werner syndrome DNA helicase at rates and to an extent that exceeded the unwinding of tetraplex form consisting of monotonous d(CGG)₁₈. Diminished formation and stability of tetraplex structures of d(AGG)-containing FMR1 d(CGG)_2–50 tracts might restrict their expansion in normal individuals.     

Interactions between the Werner syndrome helicase and DNA polymerase delta specifically facilitate copying of tetraplex and hairpin structures of the d(CGG)n trinucleotide repeat sequence

Werner syndrome (WS) is an inherited disorder characterized by premature aging and genomic instability. The protein encoded by the WS gene, WRN, possesses intrinsic 3' --> 5' DNA helicase and 3' --> 5' DNA exonuclease activities. WRN helicase resolves alternate DNA structures including tetraplex and triplex DNA, and Holliday junctions. Thus, one function of WRN may be to unwind secondary structures that impede cellular DNA transactions. We report here that hairpin and G'2 bimolecular tetraplex structures of the fragile X expanded sequence, d(CGG)(n), effectively impede synthesis by three eukaryotic replicative DNA polymerases (pol): pol alpha, pol delta, and pol epsilon. The constraints imposed on pol delta-catalyzed synthesis are relieved, however, by WRN; WRN facilitates pol delta to traverse these template secondary structures to synthesize full-length DNA products. The alleviatory effect of WRN is limited to pol delta; neither pol alpha nor pol epsilon can traverse template d(CGG)(n) hairpin and tetraplex structures in the presence of WRN. Alleviation of pausing by pol delta is observed with Escherichia coli RecQ but not with UvrD helicase, suggesting a concerted action of RecQ helicases and pol delta. Our findings suggest a possible role of WRN in rescuing pol delta-mediated replication at forks stalled by unusual DNA secondary structures.     

Stability of the Human Fragile X (CGG)n Triplet Repeat Array in Saccharomyces cerevisiae Deficient in Aspects of DNA Metabolism

Expanded trinucleotide repeats underlie a growing number of human diseases. The human FMR1 (CGG)(n) array can exhibit genetic instability characterized by progressive expansion over several generations leading to gene silencing and the development of the fragile X syndrome. While expansion is dependent upon the length of uninterrupted (CGG)(n), instability occurs in a limited germ line and early developmental window, suggesting that lineage-specific expression of other factors determines the cellular environment permissive for expansion. To identify these factors, we have established normal- and premutation-length human FMR1 (CGG)(n) arrays in the yeast Saccharomyces cerevisiae and assessed the frequency of length changes greater than 5 triplets in cells deficient in various DNA repair and replication functions. In contrast to previous studies with Escherichia coli, we observed a low frequency of orientation-dependent large expansions in arrays carrying long uninterrupted (CGG)(n) arrays in a wild-type background. This frequency was unaffected by deletion of several DNA mismatch repair genes or deletion of the EXO1 and DIN7 genes and was not enhanced through meiosis in a wild-type background. Array contraction occurred in an orientation-dependent manner in most mutant backgrounds, but loss of the Sgs1p resulted in a generalized increase in array stability in both orientations. In contrast, FMR1 arrays had a 10-fold-elevated frequency of expansion in a rad27 background, providing evidence for a role in lagging-strand Okazaki fragment processing in (CGG)(n) triplet repeat expansion.     

Destabilization of tetraplex structures of the fragile X repeat sequence (CGG)n is mediated by homolog-conserved domains in three members of the hnRNP family

Hairpin or tetrahelical structures formed by a d(CGG)_n sequence in the FMR1 gene are thought to promote expansion of the repeat tract. Subsequent to this expansion FMR1 is silenced and fragile X syndrome ensues. The injurious effects of d(CGG)_n secondary structures may potentially be countered by agents that act to decrease their stability. We showed previously that the hnRNP-related protein CBF-A destabilized G′2 bimolecular tetraplex structures of d(CGG)_n. Analysis of mutant proteins revealed that the CBF-A-conserved domains RNP1₁ and ATP/GTP binding box were sufficient and necessary for G′2 d(CGG)_n disruption while the RNP2₁ motif inhibited the destabilization activity. Here, we report that a C-terminal fragment of CBF-A whose only remaining conserved domain was the ATP/GTP binding motif, disrupted G′2 d(CGG)_n more selectively than wild-type CBF-A. Further, two additional members of the hnRNP family, hnRNP A2 and mutant hnRNP A1 effectively destabilized G′2 d(CGG)_n. Examination of mutant hnRNP A2 proteins revealed that, similar to CBF-A, their RNP1₁ element and ATP/GTP binding motif mediated G′2 d(CGG)_n disruption, while the RNP2₁ element blocked their action. Similarly, the RNP1₁ and RNP2₁ domains of hnRNP A1 were, respectively, positive and negative mediators of G′2 d(CGG)_n destabilization. Last, employing the same conserved motifs that mediated disruption of the DNA tetraplex G′2 d(CGG)_n, hnRNP A2 destabilized r(CGG)_n RNA tetraplex.     

<Emphasis Type="Italic">FMR1</Emphasis> haplotype analyses among Indians: a weak founder effect and other findings

This study on allelic/haplotypic fragile X associations evaluated using STR (DXS548, FRAXAC1, FRAXAC2) and SNP (ATL1) markers flanking the (CGG)(n) locus of FMR1is the first report from the large ethnically complex Indian population. Results have been compared with allele/haplotype distributions reported for other major ethnic groups, including White Caucasians, Africans, and Pacific Asians. Though overall allele frequency distributions at the individual loci are more similar to Western Caucasians compared with others, significant differences are observed in haplotypic associations with the mutated X. The striking findings are: (1) high diversity and heterozygosity of haplotypes among fragile X chromosomes ( n=40) and controls ( n=262), including four haplotypes found exclusively in this study sample; (2) weak association of DXS548-FRAXAC1-FRAXAC2 haplotypes, 2-1-3, 6-3-3+ and 7-4-6+ with the disorder, and absence of White Caucasian fragile X haplotypes 6-4-4 and 6-4-5; (3) weak founder effect for the fragile X expansion mutation in the Indians; (4) lack of a continuum of haplotype-based FMR1 alleles between intermediate (CGG)(n) size ranges and expanded alleles; (5) exclusion of ATL1 as a candidate genetic indicator of FMR1 instability. The high STR-based haplotype diversity observed among fragile X lineages, irrespective of ethnic alliances, strongly suggests the inappropriateness of using STR haplotypes to infer predisposition to instability among ethnically separated fragile X pedigrees and may reiterate the need for identifying newer SNPs from this region to not only determine true founder effects for the fragile X mutation, but also decipher possible mechanisms leading to CGG instability.     

An origin of DNA replication in the promoter region of the human fragile X mental retardation (FMR1) gene

Fragile X syndrome, the most common form of inherited mental retardation in males, arises when the normally stable 5 to 50 CGG repeats in the 5' untranslated region of the fragile X mental retardation protein 1 (FMR1) gene expand to over 200, leading to DNA methylation and silencing of the FMR1 promoter. Although the events that trigger local CGG expansion remain unknown, the stability of trinucleotide repeat tracts is affected by their position relative to an origin of DNA replication in model systems. Origins of DNA replication in the FMR1 locus have not yet been described. Here, we report an origin of replication adjacent to the FMR1 promoter and CGG repeats that was identified by scanning a 35-kb region. Prereplication proteins Orc3p and Mcm4p bind to chromatin in the FMR1 initiation region in vivo. The position of the FMR1 origin relative to the CGG repeats is consistent with a role in repeat maintenance. The FMR1 origin is active in transformed cell lines, fibroblasts from healthy individuals, fibroblasts from patients with fragile X syndrome, and fetal cells as early as 8 weeks old. The potential role of the FMR1 origin in CGG tract instability is discussed.     

Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n

Formation of hairpin or tetraplex structures of the FMR1 gene d(CGG)_n sequence triggers its expansion, setting off fragile X syndrome. In searching for proteins that destabilize d(CGG)_n secondary structures we purified from rat liver quadruplex telomeric DNA binding protein 42 (qTBP42) that disrupts G′2 bimolecular tetraplex d(CGG)_n while paradoxically stabilizing the G′2 structure of the telomeric sequence d(TTAGGG)_n. Based on peptide sequence homology of qTBP42 and mouse CArG-box binding factor A (CBF-A), we provide direct evidence that recombinant CBF-A protein is physically and immunochemically indistinguishable from qTBP42 and that it too destabilizes G′2 d(CGG)_n while stabilizing G′2 d(TTAGGG)_n. We inquired whether CBF-A employs the same or different domains to differentially interact with G′2 d(CGG)_n and G′2 d(TTAGGG)_n. Mutant CBF-A proteins that lack each or combinations of its five conserved motifs: RNP1₁, RNP1₂, RNP2₁, RNP2₂ and ATP/GTP-binding box were tested for their G′2 d(CGG)_n destabilization and G′2 d(TTAGGG)_n stabilization activities. We find that either RNP1₁ or the ATP/GTP motifs are necessary and sufficient for G′2 d(CGG)_n destabilization whereas RNP2₁ suppresses destabilization by either one of these two motifs. Neither RNP1₁ nor the ATP/GTP motif are required for G′2 d(TTAGGG)_n stabilization. Hence, CBF-A employs different domains to destabilize G′2 d(CGG)_n or stabilize G′2 d(TTAGGG)_n.     

Cloned human FMR1 trinucleotide repeats exhibit a length- and orientation-dependent instability suggestive of in vivo lagging strand secondary structure.

The normal human FMR1 gene contains a genetically stable (CGG) n trinucleotide repeat which usually carries interspersed AGG triplets. An increase in repeat number and the loss of interspersions results in array instability, predominantly expansion, leading to FMR1 gene silencing. Instability is directly related to the length of the uninterrupted (CGG) n repeat and is widely assumed to be related to an increased propensity to form G-rich secondary structures which lead to expansion through replication slippage. In order to investigate this we have cloned human FMR1 arrays with internal structures representing the normal, intermediate and unstable states. In one replicative orientation, arrays show a length-dependent instability, deletions occurring in a polar manner. With longer arrays these extend into the FMR1 5'-flanking DNA, terminating at either of two short CGG triplet arrays. The orientation-dependent instability suggests that secondary structure forms in the G-rich lagging strand template, resolution of which results in intra-array deletion. These data provide direct in vivo evidence for a G-rich lagging strand secondary structure which is believed to be involved in the process of triplet expansion in humans.     

The quadruplex r(CGG)n destabilizing cationic porphyrin TMPyP4 cooperates with hnRNPs to increase the translation efficiency of fragile X premutation mRNA

The 5′ untranslated region of the FMR1 gene which normally includes 4–55 d(CGG) repeats expands to > 55–200 repeats in carriers of fragile X syndrome premutation. Although the levels of premutation FMR1 mRNA in carrier cells are 5–10-fold higher than normal, the amount of the product FMR protein is unchanged or reduced. We demonstrated previously that premutation r(CGG)_n tracts formed quadruplex structures that impeded translation and lowered the efficiency of protein synthesis. Normal translation could be restored in vivo by the quadruplex r(CGG)_n destabilizing action of CBF-A and hnRNP A2 proteins. Here we report that the quadruplex-interacting cationic porphyrin TMPyP4 by itself and in cooperation with CBF-A or hnRNP A2 also unfolded quadruplex r(CGG)_n and increased the efficiency of translation of 5′-(CGG)₉₉ containing reporter firefly (FL) mRNA. TMPyP4 destabilized in vitro a (CGG)₃₃ intramolecular quadruplex structure and enhanced the translation of 5′-(CGG)₉₉-FL mRNA in a rabbit reticulocyte lysate and in HEK293 cells. The efficiency of translation of (CGG)₉₉-FL mRNA was additively increased in cells exposed to TMPyP4 together with CBF-A. Whereas low doses of TMPyP4, CBF-A or hnRNP A2 by themselves did not affect the in vivo utilization of (CGG)₉₉-FL mRNA, introduction of TMPyP4 together with either protein synergistically augmented its translation efficiency.     

Gene structure and expression of the 5'-(CGG)(n)-3'-binding protein (CGGBP1)

The human nuclear 5'-(CGG)(n)-3'-binding protein (CGGBP1) influences the expression of the fragile X mental retardation (FMR1) gene by specifically interacting with the 5'-(CGG)(n>5)-3' repeat in its 5' untranslated region. Here, we show that CGGBP1 binds to 5'-(CGG)(n)-3' repeats with n>or=5 and to interrupted repeats. The genomic and mRNA organization of the human and murine CGGBP1 genes was studied and the human gene was mapped to chromosome 3p. Due to alternative polyadenylation, mRNAs of 1.2 and 4.5 kb are transcribed at varying ratios in human and murine cells and in embryonic, fetal, and adult tissues. The human and the murine genes, including promoters and large parts of the untranslated regions, are highly conserved. A sequence of 235 nucleotides 5' upstream of CGGBP1 is essential for promoter activity in transfection experiments. Complete in vitro methylation inactivates the promoter, which is unmethylated in human cells as shown by bisulfite genomic sequencing.     

Screening for FXTAS in 95 Spanish patients negative for Huntington disease

Fragile X syndrome is the most common form of hereditary mental retardation. The molecular basis of this syndrome is mainly a CGG expansion in the 5' untranslated region of the FMR1 gene. Expansions with more than 200 CGG repeats abolish gene expression causing the classical fragile X phenotype. Premutation carriers (55-200 CGG) have normal cognitive function with increased risk of developing premature ovarian failure and fragile X-associated tremor-ataxia syndrome (FXTAS). Some clinical features associated with FXTAS, such as tremor, gait ataxia, cognitive decline, and generalized brain atrophy, are also seen in other movement disorders. Ninety-five patients referred for HD, who tested negative for the expansion in the IT15 gene, were screened for FMR1 CGG-repeat expansion. One FMR1 premutation male carrier was detected, giving an FXTAS frequency of 1.6%. Our results highlight that FXTAS is still not well diagnosed; therefore, we recommend FMR1 premutation screenings in all patients with late-onset tremor, ataxia, and cognitive dysfunction.