The transfer RNA processing defect in Escherichia coli strains BN and CAN is not due to a mutation in RNAase D or RNAase II

Escherichia coli strains BN and CAN are unable to support the growth of bacteriophage T4 psu₁⁺-amber double mutants. For strain BN, this phenotype has been attributed to a defect in 3′ processing of the precursor to psu₁⁺ tRNA^Ser. Since RNAase D and RNAase II are the only well-characterized 3′ exoribonucleases to be implicated in tRNA processing, the status of these activities and their genes in the mutant strains was investigated. Although extracts of strains BN and CAN were defective for hydrolysis of the artificial tRNA precursor, tRNA-C-U, these strains contained normal levels of RNAase D and RNAase II, and purified RNAase D or RNAase II could only partially complement the mutant extracts. Introduction of the wild-type RNAase D gene into strains BN and CAN did not correct the mutant phenotype. Likewise, strains defective in RNAase D and/or RNAase II plated T4psu₁⁺-amber phage normally. These results indicate that the tRNA processing defect in strains BN and CAN is not due to a mutation in either RNAase U or RNAase II. The possibility that the mutation in these strains affects another exoribonuclease or a factor influencing the activity and specificity of RNAase D or RNAase II is discussed.     

Cloning of genes for bacteriophage T5 stable RNAs

One EcoRI-generated fragment (440 basepairs) and two EcoRI/HindIII fragments (220 and 960 basepairs) from the deletion region of T5 phage have been inserted into the phage λ XIII and the plasmid pBR322 as vectors. Recombinant DNA molecules were studied by hybridization with in vivo ³²P-labeled T5 4–5 S RNAs on nitrocellulose filters. Two-dimensional polyacrylamide gel electrophoretic fractionation and fingerprint analysis of the RNAs eluted from the filters were carried out to identify RNAs coded by cloned fragments. For the accurate localization of the genes for these RNAs, RNA-DNA hybrids were treated with T1 and pancreatic RNAases, and the eluted RNA fragments stable against RNAase action were electrophoresed. It was shown that the EcoRI¹440 fragment contains the gene for tRNA 10 (tRNA^Asp), the EcoRI/HindIII¹220 fragment contains the gene for RNA III (107 bases) and parts of the genes for RNA I (107 bases) and tRNA 12 (tRNA^His), and the EcoRI/HindIII¹960 fragment contains only a part of the gene for tRNA 9 (tRNA^Gln). The arrangement of these genes on the physical map of T5 phage was as follows: -tRNA^Gln-tRNA^His-RNA III-RNA I-…-tRNA^Asp.     

Detection of long eukaryote-specific pyrimidine runs in repetitive DNA sequences and their relation to single-stranded regions in DNA isolated from sea urchin embryos.

Precursor molecules for Escherichia coli tRNAs that accumulated in a temperature-sensitive mutant defective in tRNA synthesis (TS709) were investigated. More than 20 precursors were purified by two-dimensional polyacrylamide gel electrophoresis. The purified molecules were analyzed by RNA fingerprint analysis and/or in vitro processing after treatment with E. coli cell-free extracts. The molecular sizes of most of the precursors identified were in the range of 4 to 5 S RNAs, although several larger ones were also detected. Fingerprint analysis revealed that the precursors generally differ from the corresponding mature tRNAs in the 5′ termini, having extra nucleotides. Thus, the genetic block in TS709 was shown to affect the trimming of the 5′ side of tRNA by impairing the function of RNAase P. Although this mutant had been isolated as a conditional mutant defective in the synthesis of su⁺ 3 tRNA₁^Tyr, the synthesis of many tRNA species was affected at high temperature. On the basis of their mode of maturation in vivo, the precursor molecules were discussed as intermediates in tRNA biosynthesis in E. coli. Accumulation of these intermediates was accounted for as a common feature of E. coli mutants defective in RNAase P function.     

A role for ribonuclease III in synthesis of bacteriophage T4 transfer RNAs.

Synthesis of T4 tRNA^Gln depends on normal levels of $\text{Escherichia}\text{coli}$ ribonuclease III. Infection of cell strains carrying a mutation in the gene for this enzyme resulted in severe depression in tRNA^Gln production, as revealed by chemical and suppressor tRNA analyses. The remaining seven T4 tRNAs were synthesized in the mutant cells. The requirement of ribonuclease III for synthesis of tRNA^Gln points to an essential cleavage by the enzyme of a precursor RNA containing tRNA^Gln.     

Physical mapping of the transfer RNA genes on lambda-h80dglytsu+36

The three Escherichia coli transfer RNA genes of the DNA of the transducing phage λ80cI857S^?t68dglyTsu⁺₃₆tyrTthrT (abbreviated λh80T), which specify the structures of tRNA^Gly₂(su⁺₃₆), tRNA^Tyr₂ and tRNA^Thr₃, have been mapped by hybridizing ferritin-labeled E. coli tRNA to heteroduplexes of λh80T DNA with the DNA of the parental phage (λh80cI857S^?t68) and examining the product in the electron microscope. The DNA of λh80T contains a piece of bacterial DNA of length 0·43 λ unit³ that replaces a piece of phage DNA of length 0·46 λ unit, proceeding left from B · P′ (the junction of bacterial DNA and phage DNA) (i.e. att⁸⁰). A cluster of three ferritin binding sites, and thus of tRNA genes, is seen at a position of 0·24 λ unit (1·1 × 10⁴ nucleotides) to the left of B· P′. The three tRNA genes of the cluster are separated by the unequal spacings of 260 (±30) and 140 (± 30) nucleotides, proceeding left from B·P′. The specific map positions have been identified by hybridization competition between ferritin-labeled whole E. coli tRNA with unlabeled purified tRNA^Tyr₂ and with unlabeled partially purified tRNA^Gly₂. The central gene of the cluster is tRNA^Tyr₂. The tRNA^Gly₂gene is probably the one furthest from B·P′. Thus, the gene order and spacings, proceeding left from B·P′, are: tRNA^Thr₃, 260 nucleotides, tRNA^Try₂, 140 nucleotides, tRNA^Gly₂.     

Identification of transfer RNA suppressors in Escherichia coli. I. Amber suppressor su+2, an anticodon mutant of tRNA2Gln.

In order to isolate the gene for amber suppressor su⁺2 (SupE) in Escherichia coli, a non-defective su⁺2-transducing phage lambda was isolated in three steps: first, deletion derivatives of F′su⁺2 gal (λ) were selected, linking su⁺2 to the right-hand prophage attachment site, att^λPB′; second, these F′-factors were relysogenized by λ and defective transducing phages, λdsu⁺2, were produced by induction; and third, non-defective λpsu⁺2 transducing phages were produced by recombination of λdsu⁺2 isolates with λ. Upon infection by λpsu⁺2, the production of transferRNAs accepting glutamine and methionine was markedly stimulated. Fingerprint analysis of these tRNAs revealed that they consisted of normal tRNA₂^Gln, mutant tRNA₂^Gln and tRNA_m^Met. The mutant tRNA₂^Gln carried a singlebase alteration from G to A at the 3′-end of the anticodon. The production of tRNA₁^Gln was not stimulated by the infection of λpsu⁺2. We conclude that the wild-type allele of su⁺2 (SupE) is the structural gene for tRNA₂^Gln, and the su⁺2 amber suppressor was derived by a single base mutation, changing the anticodon from CUG to CUA, in one of the multi-copy genes for tRNA₂^Gln. The fact that λpsu⁺2 also induces the production of tRNA_m^Met suggests that this tRNA is encoded in the same chromosomal region of E. coli as is tRNA₂^Gln.     

Association of tRNA acceptor identity with phosphate-sugar backbone interactions observed in the crystal structure of the Escherichia coli glutaminyl-tRNA synthetase-tRNA complex

We isolated several mutants with nucleotide substitutions in alanine tRNA (tRNA^Ala) that resulted in glutamine tRNA (tRNA^Gli) acceptor identity in Escherichia coli. These substitutions were in three regions of tRNA structure not previously associated with tRNA^Gln acceptor identity. Only the phosphate-sugar backbone moieties of these nucleotides interact with the enzyme in the previously determined X-ray crystal structure of the complex between tRNA^Gln and glutaminyl-tRNA synthetase. We conclude that these sequence-dependent phosphate-sugar backbone interactions contribute to tRNA^Gln identity, and argue that the interactions help communicate enzyme recognition of the anticodon to the acceptor end of the tRNA and the catalytic center of the enzyme.     

Identification of transfer RNA suppressors in Escherichia coli. II. Duplicate genes for tRNA2Gln.

The number of gene copies for tRNA₂^Gln in λpsu⁺2 was determined by genetic and biochemical studies. The transducing phage stimulates the production of the su⁺2 (amber suppressor) and su°2 glutamine tRNAs and methionine tRNA_m. When the su⁺2 amber suppressor was converted to an ochre suppressor by single-base mutation, the phage stimulated ochre-suppressing tRNA₂^Gln, instead of the amber-suppressing tRNA₂^Gln. From the transducing phage carrying the ochre-suppressing allele, strains carrying both ochre and amber suppressors were readily obtainable. These phages stimulated both ochre-suppressing and amber-suppressing tRNA₂^Gln, but not the non-suppressing form. We conclude that the original transducing phage carries two tRNA₂^Gln genes, one su⁺2 and one su°2. The transducing phage carrying two suppressors, ochre and amber, segregates one-gene derivatives that encode only one or the other type of suppressor tRNA. These derivatives apparently arise by unequal recombination involving the two glutamine tRNA genes in the parental phage. This segregation is not accompanied by the loss of the tRNA_m^Met gene. Based on these results, it is suggested that Escherichia coli normally carries in tandem two identical genes specifying tRNA₂^Gln at 15 minutes on the bacterial chromosome. su⁺2 mutants may arise by single-base mutations in the anticodon region of either of these two, leaving the other intact. By double mutations, tRNA₂^Gln genes could also become ochre suppressors. A tRNA_m^Met gene is located near, but not between, these two tRNA₂^Gln genes.     

Asymmetric maturation of a dimeric transfer RNA precursor

Six of the eight transfer RNAs coded by bacteriophage T4 are synthesized via three dimeric precursor molecules. The sequences of two of these have been determined. Both of these precursors give rise to equimolar amounts of the cognate tRNA molecules in vivo. In contrast, even in wild-type infections, tRNA^Ile is present in ≤ 30% the amount of tRNA^Thr, with which it is processed from a common dimeric precursor.We have now determined the sequence of this dimer. In addition to the nucleotides present in tRNA^Thr and tRNA^Ile, it contains nine precursor-specific residues, located at the 5′ and 3′ termini and at the interstitial junction of the two tRNA sequences. While the three dimers share the majority of structural features in common, pre-tRNA^{Thr + Ile} is the only case in which an encoded tRNA 3′ -C-C-A terminus is present in the interstitial region.The processing of this dimer in various biosynthetic mutants has been analyzed in vivo and in vitro and shown to be anomalous in several respects. These results suggest that the apparent underproduction of tRNA^Ile can be explained by a novel processing pathway that generates a metabolically unstable tRNA^Ile product. Data from DNA sequence analysis of the T4 tRNA gene cluster (Fukada & Abelson, 1980) support the conclusion that the asymmetric maturation of this precursor is a consequence of the unique disposition of the -C-C-A sequence. These results argue that gene expression can be modulated at the level of RNA processing. The biological significance of this phenomenon is discussed in relation to evidence that tRNA^Ile has a unique physiological role.     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

Coevolution of Specificity Determinants in Eukaryotic Glutamyl- and Glutaminyl-tRNA Synthetases

The glutaminyl-tRNA synthetase (GlnRS) enzyme, which pairs glutamine with tRNA^Gln for protein synthesis, evolved by gene duplication in early eukaryotes from a nondiscriminating glutamyl-tRNA synthetase (GluRS) that aminoacylates both tRNA^Gln and tRNA^Glu with glutamate. This ancient GluRS also separately differentiated to exclude tRNA^Gln as a substrate, and the resulting discriminating GluRS and GlnRS further acquired additional protein domains assisting function in cis (the GlnRS N-terminal Yqey domain) or in trans (the Arc1p protein associating with GluRS). These added domains are absent in contemporary bacterial GlnRS and GluRS. Here, using Saccharomyces cerevisiae enzymes as models, we find that the eukaryote-specific protein domains substantially influence amino acid binding, tRNA binding and aminoacylation efficiency, but they play no role in either specific nucleotide readout or discrimination against noncognate tRNA. Eukaryotic tRNA^Gln and tRNA^Glu recognition determinants are found in equivalent positions and are mutually exclusive to a significant degree, with key nucleotides located adjacent to portions of the protein structure that differentiated during the evolution of archaeal nondiscriminating GluRS to GlnRS. These findings provide important corroboration for the evolutionary model and suggest that the added eukaryotic domains arose in response to distinctive selective pressures associated with the greater complexity of the eukaryotic translational apparatus. We also find that the affinity of GluRS for glutamate is significantly increased when Arc1p is not associated with the enzyme. This is consistent with the lower concentration of intracellular glutamate and the dissociation of the Arc1p:GluRS complex upon the diauxic shift to respiratory conditions.     

Analysis of purified tRNA species by polyacrylamide gel electrophoresis

Six purified amino acid acceptor tRNA species were examined by polyacrylamide gel electrophoresis. Small differences in migration were observed under conditions that preserve the conformation of tRNA. When tRNA was heated in the presence of either 10 mM acetate or EDTA at 60° a change in migration was observed for tRNA^Glu. No difference in migration was seen between Val-tRNA^Val and tRNA^Val. When tRNA was denatured by heating in 4M urea and applied to a gel containing the same amount of urea, all tRNA species migrated approximately the same distance with the exception of tRNA^{Leu V}, which showed an appreciable slower migration. From the difference in migration of tRNA^{Leu V} as compared to tRNA^Val and 5 S RNA, the difference in chain length between tRNA^Val and tRNA^{Leu V} was estimated to be approximately 9 nucleotides.     

The archaeal transamidosome for RNA-dependent glutamine biosynthesis

Archaea make glutaminyl-tRNA (Gln-tRNA^Gln) in a two-step process; a non-discriminating glutamyl-tRNA synthetase (ND-GluRS) forms Glu-tRNA^Gln, while the heterodimeric amidotransferase GatDE converts this mischarged tRNA to Gln-tRNA^Gln. Many prokaryotes synthesize asparaginyl-tRNA (Asn-tRNA^Asn) in a similar manner using a non-discriminating aspartyl-tRNA synthetase (ND-AspRS) and the heterotrimeric amidotransferase GatCAB. The transamidosome, a complex of tRNA synthetase, amidotransferase and tRNA, was first described for the latter system in Thermus thermophilus [Bailly, M., Blaise, M., Lorber, B., Becker, H.D. and Kern, D. (2007) The transamidosome: a dynamic ribonucleoprotein particle dedicated to prokaryotic tRNA-dependent asparagine biosynthesis. Mol. Cell, 28, 228–239.]. Here, we show a similar complex for Gln-tRNA^Gln formation in Methanothermobacter thermautotrophicus that allows the mischarged Glu-tRNA^Gln made by the tRNA synthetase to be channeled to the amidotransferase. The association of archaeal ND-GluRS with GatDE (K_D = 100 ± 22 nM) sequesters the tRNA synthetase for Gln-tRNA^Gln formation, with GatDE reducing the affinity of ND-GluRS for tRNA^Glu by at least 13-fold. Unlike the T. thermophilus transamidosome, the archaeal complex does not require tRNA for its formation, is not stable through product (Gln-tRNA^Gln) formation, and has no major effect on the kinetics of tRNA^Gln glutamylation nor transamidation. The differences between the two transamidosomes may be a consequence of the fact that ND-GluRS is a class I aminoacyl-tRNA synthetase, while ND-AspRS belongs to the class II family.     

Combination of the Loss of cmnmU34 with the Lack of sU34 Modifications of tRNA, tRNA, and tRNA Altered Mitochondrial Biogenesis and Respiration

Yeast Saccharomyces cerevisiae MTO2, MTO1, and MSS1 genes encoded highly conserved tRNA modifying enzymes for the biosynthesis of carboxymethylaminomethyl (cmnm)⁵s²U₃₄ in mitochondrial tRNA^Lys, tRNA^Glu, and tRNA^Gln. In fact, Mto1p and Mss1p are involved in the biosynthesis of the cmnm⁵ group (cmnm⁵U₃₄), while Mto2p is responsible for the 2-thiouridylation (s²U₃₄) of these tRNAs. Previous studies showed that partial modifications at U₃₄ in mitochondrial tRNA enabled mto1, mto2, and mss1 strains to respire. In this report, we investigated the functional interaction between MTO2, MTO1, and MSS1 genes by using the mto2, mto1, and mss1 single, double, and triple mutants. Strikingly, the deletion of MTO2 was synthetically lethal with a mutation of MSS1 or deletion of MTO1 on medium containing glycerol but not on medium containing glucose. Interestingly, there were no detectable levels of nine tRNAs including tRNA^Lys, tRNA^Glu, and tRNA^Gln in mto2/mss1, mto2/mto1, and mto2/mto1/mss1 strains. Furthermore, mto2/mss1, mto2/mto1, and mto2/mto1/mss1 mutants exhibited extremely low levels of COX1 and CYTB mRNA and 15S and 21S rRNA as well as the complete loss of mitochondrial protein synthesis. The synthetic enhancement combinations likely resulted from the completely abolished modification at U₃₄ of tRNA^Lys, tRNA^Glu, and tRNA^Gln, caused by the combination of eliminating the 2-thiouridylation by the mto2 mutation with the absence of the cmnm⁵U₃₄ by the mto1 or mss1 mutation. The complete loss of modifications at U₃₄ of tRNAs altered mitochondrial RNA metabolisms, causing a degradation of mitochondrial tRNA, mRNA, and rRNAs. As a result, failures in mitochondrial RNA metabolisms were responsible for the complete loss of mitochondrial translation. Consequently, defects in mitochondrial protein synthesis caused the instability of their mitochondrial genomes, thus producing the respiratory-deficient phenotypes. Therefore, our findings demonstrated a critical role of modifications at U₃₄ of tRNA^Lys, tRNA^Glu, and tRNA^Gln in maintenance of mitochondrial genome, mitochondrial RNA stability, translation, and respiratory function.