Does secondary structure determine tertiary structure in proteins?

Is highly approximate knowledge of a protein's backbone structure sufficient to successfully identify its family, superfamily, and tertiary fold? To explore this question, backbone dihedral angles were extracted from the known three‐dimensional structure of 2,439 proteins and mapped into 36 labeled, 60° × 60° bins, called mesostates. Using this coarse‐grained mapping, protein conformation can be approximated by a linear sequence of mesostates. These linear strings can then be aligned and assessed by conventional sequence‐comparison methods. We report that the mesostate sequence is sufficient to recognize a protein's family, superfamily, and fold with good fidelity. Proteins 2005. © 2005 Wiley‐Liss, Inc.     

Dynamical structure of αB-crystallin

The human small heat-shock protein αB-crystallin is an extremely difficult molecule to study, with its inherent structural dynamics posing unique challenges to all biophysical and structural biology techniques. Here we highlight how the polydispersity and quaternary dynamics of αB-crystallin are intrinsically inter-twined, and how this can impact on measurements of the oligomeric distribution. We show that, in spite of these difficulties, considerable understanding of the varied fluctuations αB-crystallin undergoes at equilibrium has emerged in the last few years. By reporting on data obtained from a variety of biophysical techniques, we demonstrate how the αB-crystallin solution ensemble is governed by molecular motions of varying amplitude and time-scales spanning several orders of magnitude. We describe how these diverse measurements are being used to construct an integrated view of the dynamical structure of αB-crystallin, and highlight areas that require further interrogation. With its study motivating the refinement of experimental techniques, and the development of new approaches to combine the hybrid datasets, we conclude that αB-crystallin continues to represent a paradigm for dynamical biology.     

α-Amylase structure and activity

Two computerized methods of predicting protein secondary structure from amino acid sequences are evaluated by using them on the α-amylase ofAspergillus oryzae, for which the three-dimensional structure has been determined. The methods are then used, with amino acid alignments, to predict the structures of other α-amylases. It is found that all α-amylases of known amino acid sequence have the same basic structure, a barrel of eight parallel stretches of extended chain surrounded by eight helices. Strong similarities are found in those areas of the proteins believed to bind an essential calcium ion and at that part of the active site that catalyzes bond hydrolysis in the substrates. The active site, as a whole, is formed mainly of amino acids situated on loops joining extended chain to the adjacent helix. Variations in the length and amino acid sequence of these loops, from one α-amylase to another, provide the differences in binding the substrates believed to account for the known variations in action pattern of α-amylases of different biological origins.     

Denaturation of β-sheet structure

A two-dimensional Ising model is used to study the thermal denaturation of parallel β-sheet structures in biomolecules.The fraction of intact hydrogen bonds and the excess heat capacity are evaluated as a function of the temperature.     

Studies on solution NMR structure of brazzein——Secondary structure and molecular scaffold

Brazzein is a sweet-tasting protein isolated from the fruit of West African plant Pentadiplandra brazzeana Baillon. It is the smallest and the most water-soluble sweet protein discovered so far and is highly thermostable. The proton NMR study of brazzein at 600 MHz (pH 3.5, 300 K) is presented. The complete sequence specific assignments of the individual backbone and sideehain proton resonances were achieved using through-bond and through-space eonneetivities obtained from standard two-dimensional NMR techniques. The secondary structure of brazzein contains one α-helix (residues 21—29), one short 3_(10)-helix (residues 14—17), two strands of antiparallel β-sheet (residues 34—39, 44—50) and probably a third strand (residues 5—7) near the N-terminus. A comparative analysis found that brazzein shares a so-called 'eysteine-stabilized alpha-beta' (CSαβ) motif with scorpion neurotoxins, insect defensins and plant γ-thionins. The significance of this multi-function motif, the possible active sites an     

Studies on solution NMR structure of brazzein——Secondary structure and molecular scaffold

Brazzein is a sweet-tasting protein isolated from the fruit of West African plantPentadiplandra brazzeana Baillon. It is the smallest and the most water-soluble sweet protein discovered so far and is highly thermostable. The proton NMR study of brazzein at 600 MHz (pH 3.5, 300 K) is presented. The complete sequence specific assignments of the individual backbone and sidechain proton resonances were achieved using through-bond and through-space connectivities obtained from standard two-dimensional NMR techniques. The secondary structure of brazzein contains one alpha-helix (residues 21-29), one short 3(10)-helix (residues 14-17), two strands of antiparallel beta-sheet (residues 34-39, 44-50) and probably a third strand (residues 5-7) near the N-terminus. A comparative analysis found that brazzein shares a so-called 'cysteine-stabilized alpha-beta' (CSalphabeta) motif with scorpion neurotoxins, insect defensins and plant gamma - thionins. The significance of this multi-function motif, the possible active sites and the structural basis of themostability were discussed.     

Dicyemid’s dilemma: structure versus genes. The unorthodox structure of dicyemid reproduction

The clear phylogenetic status of the enigmatic Phylum Dicyemida is still uncertain. Their primitive body plan lacks essential metazoan synapomorphies, while genetic data favor a kinship with higher lophotrochozoans. This ultrastructural study increases the confusion about this phylum by presenting an unusual gonad and sperm structure lacking all synapomorphies essential for the various phyla of the lophotrochozoans, either free-living ones or parasites. In Dicyema typus, gonadogenesis is reduced to a single somatic cell, i.e., the infusorigen’s axial cell that functions as a somatic gonadal founder cell as soon as a spermatogonium takes residence in its cytoplasm. The spermiogenic cells resulting therefrom are not connected by intercellular bridges and permanently contain a bundle of microtubules in their cytoplasm, obviously a kind of “dormant” spindle having assembled without centrosomes. Primary spermatocytes develop so-called polycomplexes, multiple synaptinemal complexes. The structure of the sperm is based on a certain kind of somatic cell that has been minimally adapted to function as a sperm. The mature sperm consists in only three organelles: an ovoid nucleus with a somatic chromatin structure, numerous pore complexes and a centrally arranged cluster of coiled tubular structures; a bundle of microtubules embedded into a rim running along the nucleus longitudinal surface, projecting out of the cell like a spear; and a lipid vesicle tightly attached to one pole of the nucleus, touching there the adjacent bundle of microtubules. Immunelectron microscopy confirms the somatic condition of mature sperm, revealing somatic histone H1 immunoreactivity over the nucleus, which can be interpreted as synapomorphy shared with Protozoa, Porifera and Cnidaria. Fertilization occurs as selfing, where the sperm penetrates, “bundle of microtubules first”, a primary oocyte attached vis-à-vis on the other side of the plasma membrane of the infusorigen’s axial cell. This somatic situation points to an ancient evolutionary model rather than to a condition caused by retrogression due to their life as commensals.     

Secondary structure of Qβ RNA

The complete set of possible secondary structures of a variant Qβ RNA sequenced by Schaffner has been found using a computer program which allows G-U pairing as well as the usual Watson-Crick A-U and G-C pairing. Of special interest are those secondary structures with the highest double-strandedness. Omitting G-U pairing, we find the structure with the maximum double-strandedness has a pairing of 62% and exhibits a similarity to the clover leaf structure of tRNA. Including G-U pairing, the complementary strands of RNA are asymmetrical. We find maximum pairings of 71% for both the plus and minus strands. These structures also exhibit a cloverleaf structure. A similar analysis has been carried out for the secondary structure of a larger Qβ variant sequenced by Mills, Kramer and Spiegelman, but in this case there are a large number of secondary structures with the same maximum number of pairs and it is therefore not possible to select a unique structure with the maximum double-strandedness.     

Fluid–structure interaction (FSI) modeling of bone marrow through trabecular bone structure under compression

Biomechanics and Modeling in Mechanobiology - The present study has sought to investigate the fluid characteristic and mechanical properties of trabecular bone using fluid–structure...     

From protein structure to biochemical function?

Here we describe various methods currently under development aimed at identifying a proteins function from its three-dimensional structure. We are combining a number of these methods to create a pipeline of applications, called ProFunc, which will take a given 3D structure, run all the applications on it and compile and summarise the results obtained. The aim is to provide a best guess as to the proteins function from the evidence provided by the different methods. Here we present three examples, using structures solved by the Midwest Center for Structural Genomics consortium, illustrating the strengths and weaknesses of current approaches.     

Granulocyte adhesion molecules — structure/functionrelationships

Neutrophil responses are regulated by cellular adhesion events, including interaction with. extracellular matrix and other cell types. The diversity of molecular structures which are included in the repertoire of cell adhesion molecules expressed by neutrophils and their subtle regulation allow fine tuning of cell adhesion processes to suit environmental demands. This article reviews some of the recent findings using biochemical, immunochemical and molecular techniques that allow the relationship between adhesion molecule structure and function to be examined. Understanding the molecular basis of cell adhesion events will allow development of novel strategies that allow manipulation of adhesion processes in a clinical setting.     

The structure of the α-keratin microfibril

Quantitative measurements of the intensity of the meridional reflections in the X-ray-diffraction pattern of alpha-keratin are shown to be consistent with a microfibril structure in which a surface lattice with an axially projected period around 200 A is subject to a periodic interruption with an axially projected period of 470 A. Taken in conjunction with recent evidence on the chemical structure of alpha-keratin and other intermediate filaments this finding enables an elaboration to be made of a model proposed earlier by RDB Fraser, TP MacRae, & E Suzuki (J. Mol. Biol. 108, 435-452, 1976) for the alpha-helical framework of the microfibril. The disposition and connectivity of the helical segments suggested here provides a straightforward explanation of a number of recent physicochemical and electron-microscopical observations on intermediate filaments and provides a starting point for the development of models for the framework of other intermediate filaments.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

DNA structure: cations in charge?

Recent X-ray diffraction, NMR spectroscopy and molecular mechanics results suggest that monovalent cations selectively partition into the minor groove of AT-tracts in DNA. These observations are consistent with DNA deformation by electrostatic collapse around areas of uneven cation density. This model predicts the occurrence of known DNA deformations, such as AT-tract bending and changes in the minor-groove width.     

Strength and structure of spiders’ silks

Spider silks are composite materials with often complex microstructures. They are spun from liquid crystalline dope using a complicated spinning mechanism which gives the animal considerable control. The material properties of finished silk are modified by the effects of water and other solvents, and spiders make use of this to produce fibres with specific qualities. The surprising sophistication of spider silks and spinning technologies makes it imperative for us to understand both material and manufacturing in nature before embarking on the commercialization of biotechnologically modified silk dope.     

Novel antifungal α-hairpinin peptide from Stellaria media seeds: structure, biosynthesis, gene structure and evolution

Plant defense against disease is a complex multistage system involving initial recognition of the invading pathogen, signal transduction and activation of specialized genes. An important role in pathogen deterrence belongs to so-called plant defense peptides, small polypeptide molecules that present antimicrobial properties. Using multidimensional liquid chromatography, we isolated a novel antifungal peptide named Sm-AMP-X (33 residues) from the common chickweed (Stellaria media) seeds. The peptide sequence shows no homology to any previously described proteins. The peculiar cysteine arrangement (C¹X₃C²X_nC³X₃C⁴), however, allocates Sm-AMP-X to the recently acknowledged α-hairpinin family of plant defense peptides that share the helix-loop-helix fold stabilized by two disulfide bridges C¹–C⁴ and C²–C³. Sm-AMP-X exhibits high broad-spectrum activity against fungal phytopathogens. We further showed that the N- and C-terminal “tail” regions of the peptide are important for both its structure and activity. The truncated variants Sm-AMP-X1 with both disulfide bonds preserved and Sm-AMP-X2 with only the internal S–S-bond left were progressively less active against fungi and presented largely disordered structure as opposed to the predominantly helical conformation of the full-length antifungal peptide. cDNA and gene cloning revealed that Sm-AMP-X is processed from a unique multimodular precursor protein that contains as many as 12 tandem repeats of α-hairpinin-like peptides. Structure of the sm-amp-x gene and two related pseudogenes sm-amp-x-ψ1 and sm-amp-x-ψ2 allows tracing the evolutionary scenario that led to generation of such a sophisticated precursor protein. Sm-AMP-X is a new promising candidate for engineering disease resistance in plants.     

On the computation of the tertiary structure of globular proteins—IV. Use of secondary structure information

The distance geometry approach for computing the tertiary structure of globular proteins emphasized in this series of papers (Goelet al., J. theor. Biol. 99, 705–757, 1982) is developed further. This development includes incorporation of some secondary structure information—the location of alpha helices in the primary sequence—in the algorithm to compute the tertiary structure of alpha helical globular proteins. An algorithm is developed which estimates the interresidue distances between chain-proximate helices. These distances, in conjunction with the global statistical average distances obtainable from a database of real proteins and determined by the primary sequence of the protein under study, are used to determine the tertiary structure. Five proteins, parvalbumin, hemerythrin, human hemoglobin, lamprey hemoglobin, and sperm whale myoglobin, are investigated. The root mean square (RMS) errors between the calculated structures and those determined by X-ray diffraction range from 4.78 to 7.56 Å. These RMSs are 0.21–2.76 Å lower than those estimated without the secondary structure information. Contact maps and three-dimensional backbone representations also show considerable improvements with the introduction of secondary structure information.