A study of statistical error in isothermal titration calorimetry

In isothermal titration calorimetry (ITC), the two main sources of random (statistical) error are associated with the extraction of the heat q from the measured temperature changes and with the delivery of metered volumes of titrant. The former leads to uncertainty that is approximately constant and the latter to uncertainty that is proportional to q. The role of these errors in the analysis of ITC data by nonlinear least squares is examined for the case of 1:1 binding, M+X right arrow over left arrow MX. The standard errors in the key parameters-the equilibrium constant Ko and the enthalpy DeltaHo-are assessed from the variance-covariance matrix computed for exactly fitting data. Monte Carlo calculations confirm that these "exact" estimates will normally suffice and show further that neglect of weights in the nonlinear fitting can result in significant loss of efficiency. The effects of the titrant volume error are strongly dependent on assumptions about the nature of this error: If it is random in the integral volume instead of the differential volume, correlated least-squares is required for proper analysis, and the parameter standard errors decrease with increasing number of titration steps rather than increase.     

Isothermal titration calorimetry at very low c

In the study of 1:1 binding, M + X right arrow over left arrow MX, isothermal titration calorimetry (ITC) can be used successfully at values of c=K[M](0) well below the value 1.0 that is often considered its lower limit. However, analysis of low-c ITC data may require freezing the stoichiometry parameter n, and that is thought to be prohibitive for biological systems, where n can be poorly known. Here it is noted that the least-squares estimates of the binding constant K are virtually independent of errors in n at low c, permitting reliable determination of K and, from its temperature dependence, DeltaH degrees and n, down to c=10(-4) or lower, ligand solubility permitting.     

Statistical error in isothermal titration calorimetry: variance function estimation from generalized least squares

The method of generalized least squares (GLS) is used to assess the variance function for isothermal titration calorimetry (ITC) data collected for the 1:1 complexation of Ba(2+) with 18-crown-6 ether. In the GLS method, the least squares (LS) residuals from the data fit are themselves fitted to a variance function, with iterative adjustment of the weighting function in the data analysis to produce consistency. The data are treated in a pooled fashion, providing 321 fitted residuals from 35 data sets in the final analysis. Heteroscedasticity (nonconstant variance) is clearly indicated. Data error terms proportional to q(i) and q(i)/v are well defined statistically, where q(i) is the heat from the ith injection of titrant and v is the injected volume. The statistical significance of the variance function parameters is confirmed through Monte Carlo calculations that mimic the actual data set. For the data in question, which fall mostly in the range of q(i)=100-2000 microcal, the contributions to the data variance from the terms in q(i)(2) typically exceed the background constant term for q(i)>300 microcal and v<10 microl. Conversely, this means that in reactions with q(i) much less than this, heteroscedasticity is not a significant problem. Accordingly, in such cases the standard unweighted fitting procedures provide reliable results for the key parameters, K and DeltaH(degrees) and their statistical errors. These results also support an important earlier finding: in most ITC work on 1:1 binding processes, the optimal number of injections is 7-10, which is a factor of 3 smaller than the current norm. For high-q reactions, where weighting is needed for optimal LS analysis, tips are given for using the weighting option in the commercial software commonly employed to process ITC data.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Binding of distamycin A and netropsin to the 12mer DNA duplexes containing mixed AT.GC sequences with at most five or three successive AT base pairs

Circular dichroism (CD), isothermal calorimetric titrations (ITC), and temperature-dependent UV spectroscopy were used to investigate binding of the minor groove-directed ligands distamycin A (Dst) and netropsin (Net) to the following duplexes: d(GTTAGTATTTGG). d(CCAAATACTAAC), d(GTTAGTATATGG).d(CCATATACTAAC), d(GTTAGTACTTGG). d(CCAAGTACTAAC), and d(GTTAGTAGTTGG).d(CCAACTACTAAC). Our results reveal that Dst binds within the minor grooves of these dodecamers that contain five-AT and/or four-AT.GC binding sites exclusively in a dimeric high-affinity 2:1 binding mode (K approximately 10(16) M(-)(2)). By contrast, Net exhibits high-affinity binding only when it binds in a 1:1 mode (K(1) approximately 10(9) M(-)(1)) to the two duplexes that contain five-AT sites (5'-TATTT-3' and 5'-TATAT-3'). Its further binding to these two duplexes occurs in a low-affinity mode (K(2) approximately 10(6) M(-)(1)) and results in the formation of 2:1 Net-DNA complexes. To the other two duplexes that contain sequences with at most three AT consecutive base pairs Net binds in two distinctive low-affinity 1:1 binding modes (K(1) approximately 10(7) M(-)(1), K(2) approximately 10(6) M(-)(1)). Competition experiments (CD and ITC titrations) reveal that Dst entirely displaces Net from its 1:1 and 2:1 complexes with any of the four duplexes. We discuss and interpret our optical and calorimetric results in the context of the available structural information about the complexes between DNA and the sequence-specific minor groove binders Dst and Net.     

Conformational changes of the nucleotide site of the plasma membrane Ca2+-ATPase probed by fluorescence quenching

Fluorescence quenching by the water-soluble ions I(-) and Cs(+) was used to probe solvent accessibility and polarity of the nucleotide/fluorescein isothiocyanate binding pocket of the purified soluble Ca(2+)-ATPase from plasma membranes. The E(1).Ca.CaM conformer was the least accessible state studied, presenting the lowest suppression constant (K(q)) for both I(-) (K(q) = 6.7 M(-)(1)) and Cs(+) (K(q) = 0.7 M(-)(1)). Accessibility to I(-) was similar for the E(2).VO(4) and E(1).Ca states (K(q) = 7.13 and 7.5 M(-)(1), respectively), whereas E(2) was slightly more accessible (K(q) = 9.1 M(-)(1)). The phosphorylated state E(2)-P presented the highest accessibility, with a K(q) of 16.5 M(-)(1), very near the K(q) of 20.3 M(-)(1) for free FITC. I(-) was unequivocally a better fluorescence quencher, being usually nearly 3-fold as efficient as Cs(+), as indicated by the K(q)(I(-))/K(q)(Cs(+)) ratio (R(q)). The advent of a positive charge cluster on the nucleotide/fluorescein binding pocket in different states was suggested by the increase in R(q), which reached a value as high as 9.5 for the E(1).Ca.CaM conformer. These results indicate (i) a very high water accessibility of the nucleotide/fluorescein pocket for E(2)-P that (ii) is more restricted on the free E(2) state and (iii) becomes rather lower for the E(1).Ca states. Additionally, a positive charge effect of amino acids on the nucleotide site, possibly related to ATP binding and phosphoryl transfer, appears in these E(1).Ca states, being absent in the phosphorylated and nonphosphorylated E(2) states.     

Calorimetric vs. van't Hoff binding enthalpies from isothermal titration calorimetry: Ba2+-crown ether complexation

The 1:1 complexation reaction between Ba(2+) and 18-crown-6 ether is re-examined using isothermal titration calorimetry (ITC), with the goal of clarifying previously reported discrepancies between reaction enthalpies estimated directly (calorimetric) and indirectly, from the temperature dependence of the reaction equilibrium constant K (van't Hoff). The ITC thermograms are analyzed using three different non-linear fit models based on different assumptions about the data error: constant, proportional to the heat and proportional but correlated. The statistics of the fitting indicate a preference for the proportional error model, in agreement with expectations for the conditions of the experiment, where uncertainties in the delivered titrant volume should dominate. With attention to proper procedures for propagating statistical error in the van't Hoff analysis, the differences between Delta H(cal) and Delta H(vH) are deemed statistically significant. In addition, statistically significant differences are observed for the Delta H(cal) estimates obtained for two different sources of Ba(2+), BaCl(2) and Ba(NO(3))(2). The effects are tentatively attributed to deficiencies in the standard procedure in ITC of subtracting a blank obtained for pure titrant from the thermogram obtained for the sample.     

The development of a continuous isothermal titration calorimetric method for equilibrium studies

A continuous isothermal titration calorimetry (cITC) method for microcalorimeters has been developed. The method is based on continuous slow injection of a titrant into the calorimetric vessel. The experimental time for a cITC binding experiment is 12-20 min and the number of data points obtained is on the order of 1000. This gives an advantage over classical isothermal titration calorimetry (ITC) binding experiments that need 60-180 min to generate 20-30 data points. The method was validated using two types of calorimeters, which differ in calorimetric principle, geometry, stirring, and way of delivering the titrant into the calorimetric vessel. Two different experimental systems were used to validate the method: the binding of Ba(2+) to 18-crown-6 and the binding of cytidine 2'-monophosphate to RNAse A. Both systems are used as standard test systems for titration calorimetry. Computer simulations show that the dynamic range for determination of equilibrium constants can be increased by three orders of magnitude compared to that of classical ITC, making it possible to determine high affinities. Simulations also show an improved possibility to elucidate the actual binding model from cITC data. The simulated data demonstrate that cITC makes it easier to discriminate between different thermodynamic binding models due to the higher density of data points obtained from one experiment.     

Optimizing isothermal titration calorimetry protocols for the study of 1:1 binding: Keeping it simple

BackgroundSuccessful ITC experiments require conversion of cell reagent (titrand M) to product and production or consumption of heat. These conditions are quantified for 1:1 binding, M + X ⇔ MX.MethodsNonlinear least squares is used in error-propagation mode to predict the precisions with which the key quantities — binding constant K, reaction enthalpy ΔH°, and stoichiometry number n — can be estimated over a wide range of the dimensionless quantity that governs isotherm shape, c = K[M]₀. The measurement precision σ_q is estimated from analysis of water–water blanks.ResultsWhen the product conversion exceeds 90%, the parameter relative standard errors are proportional to σ_q/q_tot, where the total heat q_tot ≈ ΔH° [M]₀ V₀. Specifically, σ_K/K × q_tot/σ_q ≈ 25 for c = 10 ^− 3 − 10, ≈ 11 c^1/3 for c = 10 − 10⁴. For c > 1, n and ΔH° are more precise than K; this holds also at smaller c for the product n × ΔH° and for ΔH° when n can be held fixed. Use of as few as 10 titrant injections can outperform the customary 20–40 while also improving productivity.ConclusionThese principles are illustrated in experiment design using the program ITC-PLANNER15.General significanceSimple quantitative guidelines replace the “c rules” that have dominated the literature for decades. This article is part of a Special Issue entitled Microcalorimetry in the BioSciences — Principles and Applications, edited by Fadi Bou-Abdallah.     

Cooperative interaction of histone H1 with DNA.

The cooperative binding of histone H1 with DNA was studied using a fluorescently labelled histone H1. The titration data were analysed in terms of the large ligand model. The stoichiometric number, n = 65 +/- 10 bases/H1, was independent of NaCl concentration (0.02 - 0.35 M). The nucleation and the cooperative binding constants, K' and K, and the cooperativity parameter q were sensitive to salt concentration; K = 3.6 +/- 0.8 X 10(7) M-1 and q = 1.1 +/- 0.4 X 10(3) at 0.2 M NaCl. The dependence of K' on NaCl concentration revealed that 6 Na+ ions were released from DNA upon complex formation. An extrapolation of K' to 1M NaCl yielded a small value, K' = 5 +/- 2 M-1. Thus the binding of H1 is essentially electrostatic, being compatible with its independence of temperature. A calculation of K' based on the counterion release reproduced the salt concentration dependence of K'. Therefore, the binding of H1 is of an electrostatic territorial type. Thus, H1 may move along the DNA chain to a certain extent, when both salt concentration and the degree of saturation are sufficiently low. The condition is so restricted that the sliding would not play an important role in vivo. It was concluded from the DNA concentration independent binding isotherm that H1 can cooperatively bind onto a single DNA molecule. A simple power law dependence of the cooperativity parameter q upon NaCl concentration was found; q oc[NaCl]h with h = 0.72, though the physical basis of this dependence remains unknown.     

Cytochrome c peroxidase-cytochrome c complex: locating the second binding domain on cytochrome c peroxidase with site-directed mutagenesis

Cytochrome c peroxidase (CcP) can bind as many as two cytochrome c (Cc) molecules in an electrostatic complex. The location of the two binding domains on CcP has been probed by photoinduced interprotein electron transfer (ET) between zinc-substituted horse cytochrome c (ZnCc) and CcP with surface charge-reversal mutations and by isothermal titration calorimetry (ITC). These results, which are the first experimental evidence for the location of domain 2, indicate that the weak-binding domain includes residues 146-150 on CcP. CcP(E290K) has a charge-reversal mutation in the tight-binding domain, which should weaken binding, and it weakens the 1:1 complex; K(1) decreases 20-fold at 18 mM ionic strength. We have employed two mutations to probe the proposed location for the weak-binding domain on the CcP surface: (i) D148K, a "detrimental" mutation with a net (+2) change in the charge of CcP, and (ii) K149E, a "beneficial" mutation with a net (-2) change in the charge. The interactions between FeCc and CcP(WT and K149E) also have been studied with ITC. The CcP(D148K) mutation causes no substantial change in the 2:1 binding but an increase in the reactivity of the 2:1 complex. The latter can be interpreted as a long-range influence on the heme environment or, more likely, the enhancement of a minority subset of binding conformations with favorable pathways for ET. CcP(K149E) has a charge-reversal mutation in the weak-binding domain that produces a substantial increase in the 2:1 binding constant as measured by both quenching and ITC. For the 1:1 complex of CcP(WT), DeltaG(1) = -8.2 kcal/mol (K(1) = 1.3 x 10(6) M(-)(1)), DeltaH(1) = +2.7 kcal/mol, and DeltaS(1) = +37 cal/K.mol at 293 K; for the second binding stage, K(2) < 5 x 10(3) M(-)(1), but accurate thermodynamic parameters were not obtained. For the 1:1 complex of CcP(K149E), DeltaG(1) = -8.5 kcal/mol (K(1) = 2 x 10(6) M(-)(1)), DeltaH(1) = +2. 0 kcal/mol, and DeltaS(1) = +36 cal/K.mol; for the second stage, DeltaG(2) = -5.5 kcal/mol (K(1) = 1.3 x 10(4) M(-)(1)), DeltaH(2) = +2.9 kcal/mol, and DeltaS(2) = +29 cal/K.mol.     

A "release" protocol for isothermal titration calorimetry

Isothermal titration calorimetry (ITC) has become a standard method for investigating the binding of ligands to receptor molecules or the partitioning of solutes between water and lipid vesicles. Accordingly, solutes are mixed with membranes (or ligands with receptors), and the subsequent heats of incorporation (or binding) are measured. In this paper we derive a general formula for modeling ITC titration heats in both binding and partitioning systems that allows for the modeling of the classic incorporation or binding protocols, as well as of new protocols assessing the release of solute from previously solute-loaded vesicles (or the dissociation of ligand/receptor complexes) upon dilution. One major advantage of a simultaneous application of the incorporation/binding and release protocols is that it allows for the determination of whether a ligand is able to access the vesicle interior within the time scale of the ITC experiment. This information cannot be obtained from a classical partitioning experiment, but it must be known to determine the partition coefficient (or binding constant and stochiometry) and the transfer enthalpy. The approach is presented using the partitioning of the nonionic detergent C12EO7 to palmitoyloleoylphosphatidylcholine vesicles. The release protocol could also be advantageous in the case of receptors that are more stable in the ligand-saturated rather than the ligand-depleted state.     

Roles of phosphorylation-dependent and -independent mechanisms in the regulation of M1 muscarinic acetylcholine receptors by G protein-coupled receptor kinase 2 in hippocampal neurons

When co-expressed with the inositol 1,4,5-trisphosphate biosensor eGFP-PH(PLC delta), G protein-coupled receptor kinase 2 (GRK2) can suppress M1 muscarinic acetylcholine (mACh) receptor-mediated phospholipase C signaling in hippocampal neurons through a phosphorylation-independent mechanism, most likely involving the direct binding of the RGS homology domain of GRK2 to G alpha(q/11). To define the importance of this mechanism in comparison with classical, phosphorylation-dependent receptor regulation by GRKs, we have examined M1 mACh receptor signaling in hippocampal neurons following depletion of GRK2 and also in the presence of non-G alpha(q/11)-binding GRK2 mutants. Depletion of neuronal GRK2 using an antisense strategy almost completely inhibited M1 mACh receptor desensitization without enhancing acute agonist-stimulated phospholipase C activity. By stimulating neurons with a submaximal agonist concentration before (R1) and after (R2) a period of exposure to a maximal agonist concentration, an index (R2/R1) of agonist-induced desensitization of signaling could be obtained. Co-transfection of neurons with either a non-G alpha(q/11)-binding (D110A) GRK2 mutant or the catalytically inactive (D110A,K220R)GRK2 did not suppress acute M1 mACh receptor-stimulated inositol 1,4,5-trisphosphate production. However, using the desensitization (R2/R1) protocol, it could be shown that expression of (D110A)GRK2 enhanced, whereas (D110A,K220R)GRK2 inhibited, agonist-induced M1 mACh receptor desensitization. In Chinese hamster ovary cells, the loss of G alpha(q/11) binding did not affect the ability of the (D110A)GRK2 mutant to phosphorylate M1 mACh receptors, whereas expression of (D110A,K220R)GRK2 had no effect on receptor phosphorylation. These data indicate that in hippocampal neurons endogenous GRK2 is a key regulator of M1 mACh receptor signaling and that the regulatory process involves both phosphorylation-dependent and -independent mechanisms.     

Thermodynamics of ion-induced RNA folding in the hammerhead ribozyme: an isothermal titration calorimetric study

The hammerhead ribozyme undergoes a well-defined two-stage conformational folding process, induced by the binding of magnesium ions. In this study, we have used isothermal titration calorimetry to analyze the thermodynamics of magnesium binding and magnesium ion-induced folding of the ribozyme. Binding to the natural sequence ribozyme is strongly exothermic and can be analyzed in terms of sequential interaction at two sites with association constants K(A) = 480 and 2840 M(-1). Sequence variants of the hammerhead RNA give very different isothermal titration curves. An A14G variant that cannot undergo ion-induced folding exhibits endothermic binding. By contrast, a deoxyribose G5 variant that can undergo only the first of the two folding transitions gives a complex titration curve. However, despite these differences the ITC data for all three species can be analyzed in terms of the sequential binding of magnesium ions at two sites. While the binding affinities are all in the region of 10(3) M(-1), corresponding to free energies of Delta G degrees = -3.5 to -4 kcal mol(-1), the enthalpic and entropic contributions show much greater variation. The ITC experiments are in good agreement with earlier conformational studies of the folding of the ion-induced folding of the hammerhead ribozyme.     

Thermodynamics of nucleic acid "shape readout" by an aminosugar

Recognition of nucleic acids is important for our understanding of nucleic acid structure as well as for our understanding of nucleic acid-protein interactions. In addition to the direct readout mechanisms of nucleic acids such as H-bonding, shape recognition of nucleic acids is being increasingly recognized as playing an equally important role in DNA recognition. Competition dialysis, UV, flourescent intercalator displacement (FID), computational docking, and calorimetry studies were conducted to study the interaction of neomycin with a variety of nucleic acid conformations (shapes). At pH 5.5, the results suggest the following. (1) Neomycin binds three RNA structures [16S A site rRNA, poly(rA)·poly(rA), and poly(rA)·poly(rU)] with high affinities (K(a) ~ 10(7) M(-1)). (2) The binding of neomycin to A-form GC-rich oligomer d(A(2)G(15)C(15)T(2))(2) has an affinity comparable to those of RNA structures. (3) The binding of neomycin to DNA·RNA hybrids shows a 3-fold variance that can be attributed to their structural differences [for poly(dA)·poly(rU), K(a) = 9.4 × 10(6) M(-1), and for poly(rA)·poly(dT), K(a) = 3.1 × 10(6) M(-1)]. (4) The interaction of neomycin with DNA triplex poly(dA)·2poly(dT) yields a binding affinity (K(a)) of 2.4 × 10(5) M(-1). (5) Poly(dA-dT)(2) shows the lowest association constant for all nucleic acids studied (K(a) < 10(5)). (6) Neomycin binds to G-quadruplexes with K(a) values of ~10(4)-10(5) M(-1). (7) Computational studies show that the decrease in major groove width in the B to A transition correlates with increasing neomycin affinity. Neomycin's affinity for various nucleic acid structures can be ranked as follows: RNAs and GC-rich d(A(2)G(15)C(15)T(2))(2) structures > poly(dA)·poly(rU) > poly(rA)·poly(dT) > T·A-T triplex, G-quadruplex, B-form AT-rich, or GC-rich DNA sequences. The results illustrate the first example of a small molecule-based "shape readout" of different nucleic acid conformations.     

Thermodynamics and folding pathway of tetraloop receptor-mediated RNA helical packing

Little is known about the thermodynamic forces that drive the folding pathways of higher-order RNA structure. In this study, we employ calorimetric [isothermal titration calorimetry (ITC) and differential scanning calorimetry (DSC)] and spectroscopic (NMR and UV) methods to characterize the thermodynamics of the GAAA tetraloop-receptor interaction, utilizing a previously described bivalent construct. ITC studies indicate that the bivalent interaction is enthalpy driven and highly stable, with a binding constant (K(obs)) of 5.5x10(6) M(-1) and enthalpy (DeltaH(obs)(o)) of -33.8 kcal/mol at 45 degrees C in 20 mM KCl and 2 mM MgCl(2). Thus, we derive the DeltaH(obs)(o) for a single tetraloop-receptor interaction to be -16.9 kcal/mol at these conditions. UV absorbance data indicate that an increase in base stacking quality contributes to the enthalpy of complex formation. These highly favorable thermodynamics are consistent with the known critical role for the tetraloop-receptor motif in the folding of large RNAs. Additionally, a significant heat capacity change (DeltaC(p,obs)(o)) of -0.24 kcal mol(-1) K(-1) was determined by ITC. DSC and UV-monitored thermal denaturation experiments indicate that the bivalent tetraloop-receptor construct follows a minimally five-state unfolding pathway and suggest the observed DeltaC(p,obs)(o) for the interaction results from a temperature-dependent unbound receptor RNA structure.     

Isothermal titration calorimetry of protein-protein interactions.

The interaction of biologicalmacromolecules, whether protein-DNA, antibody-antigen, hormone-receptor, etc., illustrates the complexity and diversity of molecular recognition. The importance of such interactions in the immune response, signal transduction cascades, and gene expression cannot be overstated. It is of great interest to determine the nature of the forces that stabilize the interaction. The thermodynamics of association are characterized by the stoichiometry of the interaction (n), the association constant (K(a)), the free energy (DeltaG(b)), enthalpy (DeltaH(b)), entropy (DeltaS(b)), and heat capacity of binding (DeltaC(p)). In combination with structural information, the energetics of binding can provide a complete dissection of the interaction and aid in identifying the most important regions of the interface and the energetic contributions. Various indirect methods (ELISA, RIA, surface plasmon resonance, etc.) are routinely used to characterize biologically important interactions. Here we describe the use of isothermal titration calorimetry (ITC) in the study of protein-protein interactions. ITC is the most quantitative means available for measuring the thermodynamic properties of a protein-protein interaction. ITC measures the binding equilibrium directly by determining the heat evolved on association of a ligand with its binding partner. In a single experiment, the values of the binding constant (K(a)), the stoichiometry (n), and the enthalpy of binding (DeltaH(b)) are determined. The free energy and entropy of binding are determined from the association constant. The temperature dependence of the DeltaH(b) parameter, measured by performing the titration at varying temperatures, describes the DeltaC(p) term. As a practical application of the method, we describe the use of ITC to study the interaction between cytochrome c and two monoclonal antibodies.     

A kinetically trapped intermediate of FK506 binding protein forms in vitro: chaperone machinery dominates protein folding in vivo

We have characterised the stability, binding and enzymatic properties of three human FK506 binding proteins (FKBP-12) differing only by the length and sequence of their N-terminus. One construct has a short hexa-his tag (6H-FKBP12); the second longer fusion protein (6HL-FKBP12) contains an additional thrombin protease cleavage site; the third has the long fusion tag removed and is essentially native FKBP-12 (cFKBP12). The proteins were purified both under native conditions and also using a refolding protocol. All three natively purified proteins have, within experimental error, the same peptidyl-prolyl isomerase (PPIase) activity (k(cat)/K(m) approximately 1 x 10(6)M(-1)s(-1)), and bind a natural inhibitor, rapamycin, with the same high affinity (K(d) approximately 6 nM). However, refolding of the protein containing the longer tag in vitro results in reduced PPIase activity (the k(cat)/K(m) was reduced from 1 x 10(6)M(-1)s(-1) to 0.81 x 10(6)M(-1)s(-1)) and a 6-fold affinity loss for rapamycin. Addition of both the long and short N-terminal his-tags slows the refolding kinetics of FKBP-12. However, the shorter his-tagged fusion protein regains fully native activity (> or =95%) while the longer regains only approximately 80-85% of native activity. Equilibrium urea denaturation titrations, isothermal titration calorimetry (ITC), analytical gel-filtration, and fluorescence binding data show that this loss of activity is not due to gross misfolding events, but is rather caused by the formation of a stable but subtly misfolded protein that has reduced peptidyl-prolyl isomerase (PPIase) activity and reduced affinity for rapamycin. The difference in behaviour between the in vitro refolded and native forms is due to the dominant role of the cellular chaperone/folding machinery.     

Increased precision for analysis of protein–ligand dissociation constants determined from chemical shift titrations

NMR is ideally suited for the analysis of protein-protein and protein ligand interactions with dissociation constants ranging from ~2 μM to ~1 mM, and with kinetics in the fast exchange regime on the NMR timescale. For the determination of dissociation constants (K ( D )) of 1:1 protein-protein or protein-ligand interactions using NMR, the protein and ligand concentrations must necessarily be similar in magnitude to the K ( D ), and nonlinear least squares analysis of chemical shift changes as a function of ligand concentration is employed to determine estimates for the parameters K ( D ) and the maximum chemical shift change (Δδ(max)). During a typical NMR titration, the initial protein concentration, [P (0)], is held nearly constant. For this condition, to determine the most accurate parameters for K ( D ) and Δδ(max) from nonlinear least squares analyses requires initial protein concentrations that are ~0.5 × K ( D ), and a maximum concentration for the ligand, or titrant, of ~10 × [P (0)]. From a practical standpoint, these requirements are often difficult to achieve. Using Monte Carlo simulations, we demonstrate that co-variation of the ligand and protein concentrations during a titration leads to an increase in the precision of the fitted K ( D ) and Δδ(max) values when [P (0)] > K ( D ). Importantly, judicious choice of protein and ligand concentrations for a given NMR titration, combined with nonlinear least squares analyses using two independent variables (ligand and protein concentrations) and two parameters (K ( D ) and Δδ(max)) is a straightforward approach to increasing the accuracy of measured dissociation constants for 1:1 protein-ligand interactions.     

Characterization of the binding of 8-anilinonaphthalene sulfonate to rat class Mu GST M1-1

Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulfonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5-30 degrees C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a DeltaC(p) of -80+/-4 cal K(-1) mol(-1) indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins.