Molecular cloning and nucleotide sequence of a gene encoding a cotton palmitoyl-acyl carrier protein thioesterase.

A cotton genomic clone containing a 17.4-kb DNA segment was found to encompass a palmitoyl-acyl carrier protein (ACP) thioesterase (Fat B1) gene. The gene spans 3.6 kb with six exons and five introns, and is apparently the first plant FatB acyl-ACP thioesterase gene to be completely sequenced. The six exons are identical in nucleotide sequence to the open reading frame of the corresponding cDNA, and would encode a preprotein of 413 amino acids. The preprotein can clearly be identified as a FatB acyl-ACP thioesterase from its similarity to the deduced amino acid sequences of other FatB thioesterase preproteins. A 5'-flanking region of 914 bp was sequenced, with the potential TATA basal promoter 324 bp upstream from the ATG initiation codon. The 5'-flanking sequence also has a putative CAAT box and two presumptive basic region helixloop-helix (bHLH) elements with the consensus motif CANNTG (termed an E box), implicated as being a positive regulatory element in seed-specific gene expression.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Isolation and characterization of the mouse CD8 beta-chain (Ly-3) genes. Absence of an intervening sequence between V- and J-like gene segments

We have isolated and determined the nucleotide sequence and genomic organization of the genes encoding Ly-3.1 and Ly-3.2. These genes span approximately 14 kb on chromosome 6 and consist of six exons and five introns. The exons correlate roughly with the putative functional domains, namely, a leader exon, a variable and joining region-like exon, a hinge region-like exon, a transmembrane exon, and two intracytoplasmic exons. There is no intervening sequence between V- and J-like gene segments, indicating that rearrangement is not necessary for the expression of the Ly-3 gene. In the 5'-flanking region there is no "TATA" box nor "CAAT" box; however, three "GC" boxes are located upstream of the ATG initiator codon. There are short stretches of sequence homologous to 5'-flanking sequences of the Ly-2 gene. In addition, the sequences CTCTGTGGCA at -748 exhibits homology to the enhancer core sequence of the human Ig H chain and TCR genes. Comparison of the nucleotide sequence corresponding to the extracellular portion between Ly-3.1 and Ly-3.2 revealed a single base difference which results in an amino acid substitution. Therefore it is likely that this amino acid difference is responsible for the previously defined Ly-3 allotypes.