Restriction Enzyme-Resistant High Molecular Weight Telomeric DNA Fragments in Tobacco

Restriction endonuclease-resistant high-molecular-weight (HMW)DNA fragments were isolated from nuclear DNA fragments in tobacco.The size of the fragments produced by EcoRI, HindIII, AfaI,and HaeIII ranged from 20 kb to over 166 kb. The kinetics ofdigestion by Bal31 nuclease showed that most of the HMW fragmentsare chromosome ends. The consensus sequence for tobacco telomererepeats was determined to be CCCTAAA by genomic sequencing usingthe HMW fragments and by sequencing after cloning. Besides thetelomere sequence, 9 tandem repeats of a 45-bp sequence wereidentified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT)formed a stem structure. The front of the stem is composed ofa palindrome of the telomere repeats. This highly conservedunit is surrounded by less conserved internal sequences thatare around 10–11 bp in size and contain a TTTT stretch.The internal sequences resemble the 10–11 bp consensusfor the scaffold attachment regions found in yeast and drosophila.The characteristic 45-bp sequence was abundant on the ends ofchromosomes. The shortest distance between the repeats containingtelomeric stem and the telomere was less than 20 kb. This architectureof the tobacco chromosome end region resembles the end regionof yeast chromosomes in which autonomous replication sequencesare present frequently.