Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells

A lysine tRNA (anticodon U¹UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm¹Am²GCUUAGAGCm²GUUAACCU$\text{U}{}^1\text{UU}$-t⁶AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA_OH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U¹27 (probably 5-methoxycarbonylmethyluridine) and t⁶A30 (N-N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U¹ in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t⁶A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon.