Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs (aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs (a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.