Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH₃)CH₂(RCl)(II-PS) and (RCl)CH₂N(CH₃)pGpsCpsAps TpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl=C₆H₄N(CH₃)(CH₂CH₂Cl) at the 3′- or 5′-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (att→∞) at 20°C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH₃)CH₂(RCl)(II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex. For Part III, see 1].