Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër