Molecular cloning and characterization of CD14 gene in goat
Institution:
1. Animal Genetics Division, Indian Veterinary Research Institute, Izatnagar, U.P., India;2. Animal Nutrition Division, Indian Veterinary Research Institute, Izatnagar, U.P., India;1. Dipartimento di Scienze, Università della Basilicata, Viale dell’Ateneo Lucano, 10-85100 Potenza, Italy;2. Istituto di Struttura della Materia, Consiglio Nazionale delle Ricerche, CNR-ISM, Via del Fosso del Cavaliere, 100-00133 Rome, Italy;3. Department of Engineering, University of Rome “Niccolò Cusano”, INSTM RU, Via Don Carlo Gnocchi 3, 00166 Rome, Italy;4. CNR-ISM, UOS Tito Scalo, C/da S. Loja, 85050 Tito Scalo, Potenza, Italy;1. Baku State University, Department of Chemistry, Z. Khalilov str. 23, AZ-1148 Baku, Azerbaijan;2. Institute of Physics, Azerbaijan National Academy of Sciences, H. Javid pr, 131, Baku AZ-1143, Azerbaijan;3. Institut für Technische Chemie, Leibniz Universität Hannover, Callinstrasse 5, D-30167 Hannover, Germany;4. Institut für Festkörperphysik, Leibniz Universität Hannover, Appelstrasse 2, D-30167 Hannover, Germany;1. Department of Physics, Indiana University of Pennsylvania, 975 Oakland Avenue, 56 Weyandt Hall, Indiana, PA 15705-1087, USA;2. Department of Materials Science and Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA
Abstract:
The present study was carried out in the Animal Genetics Division, Indian Veterinary Research Institute. The cDNA for CD14 gene of goat was amplified for the first time using PCR with ATGGTCTGCGTGCCCTACCTG as forward primer and GGAGCCCGAGGCTTCGCGTAA as reverse primer. The PCR product of 1122 bp was eluted, purified, cloned and sequenced by automated sequencer (ABI prism) using dideoxy chain termination method. CD14 cDNA (Gene bank Accession no. DQ457090) revealed 1122 bp nucleotide with ATG as start codon followed by an open reading frame of 1116 nucleotides and TAA as stop codon. GC content of caprine CD14 gene was found to be as high as 62.21%. The predicted peptide sequence revealed 373 amino acids precursor corresponding to coding sequence of CD14 gene and a 20 amino acid signal peptide. Caprine CD14 peptide is of higher Mol wt. than buffalo, but lesser than cattle. Caprine CD14 cDNA gene is 92.0, 92.5, 75.7, 76.1, 69.2 and 61.7% identical to buffalo, cattle, human, dog, mouse and rat cDNA.