Rescue of a Dominant Mutant With RNA Interference

Maize Mucronate1 is a dominant floury mutant based on a misfolded 16-kDa γ-zein protein. To prove its function, we applied RNA interference (RNAi) as a dominant suppressor of the mutant seed phenotype. A γ-zein RNAi transgene was able to rescue the mutation and restore normal seed phenotype. RNA interference prevents gene expression. In most cases, this is used to study gene function by creating a new phenotype. Here, we use it for the opposite purpose. We use it to reverse the creation of a mutant phenotype by restoring the normal phenotype. In the case of the maize Mucronate1 (Mc1) phenotype, interaction of a misfolded protein with other proteins is believed to be the basis for the Mc1 phenotype. If no misfolded protein is present, we can reverse the mutant to the normal phenotype. One can envision using this approach to study complex traits and in gene therapy.TRANSLUCENT or vitreous maize kernels are harder and able to sustain stronger mechanical strength during harvesting, transportation, and storage. There is a direct link between a vitreous seed phenotype and the type of storage proteins in the seed, collectively called zeins in maize. Zeins, encoded by a multigene family, constitute >60% of all maize seed proteins. They are classified into four groups (α-, β-, γ-, and δ-zein) on the basis of their structures (Esen 1987). Zeins are specifically synthesized in the endosperm ∼10 days after pollination (DAP) and deposited into protein bodies (Wolf et al. 1967; Burr and Burr 1976; Lending and Larkins 1992). Irregularly shaped protein bodies are found in floury or opaque kernel phenotypes (Coleman et al. 1997; Kim et al. 2004, 2006; Wu et al. 2010; Wu and Messing 2010). The terms “floury” and “opaque” were originally created on the basis of the genetic behaviors of the mutant allele causing the soft kernel texture. The floury mutants behave as semidominant or dominant mutants, as floury1 and floury2 do, while the opaque mutants are recessive, as opaque1 and opaque2 are (Hayes and East 1915; Lindstrom 1923; Emerson et al. 1935; Maize Genetics Cooperation 1939). Similar to floury2 with a single mutation in the signal peptide of a 22-kDa α-zein resulting in an unprocessed protein (Coleman et al. 1995), De*-B30 produces an unprocessed 19-kDa α-zein (Kim et al. 2004). It was hypothesized that the two mutant proteins with an unprocessed signal peptide are misfolded and docked in the membranes of the rough endoplasmic reticulum (RER), blocking the deposition of other zein proteins (Coleman et al. 1995; Kim et al. 2004). In Mucronate1 (Mc1), a 38-bp deletion in the C terminus of the 16-kDa γ-zein (γ16-zein) gene resulted in a frameshift and a protein with a different amino-acid tail. This modified 16-kDa γ-zein (Δγ16-zein) has altered solubility properties, which would explain the formation of irregular protein bodies. Because De*-B30 and Mc1 are semidominant and dominant, respectively, they belong to the floury mutant class.The γ-zein genes (γ27-zein and γ16-zein) are homologous copies because maize underwent allotetraploidization and both gene copies have been retained during diploidization (Xu and Messing 2008). The two γ-zeins and the 15-kDa β-zein have a redundant function in stabilizing protein-body formation (Wu and Messing 2010). Knockdown of both γ-zeins with a single RNA interference (RNAi) construct conditioned only partial opacity in the crown, the top of the kernel, as opposed to the remainder or gown area of the kernel. Consistent with its light kernel phenotype, protein bodies in such a γ-zein RNAi (γRNAi) mutant exhibited a slight alteration in morphology. This phenotype is clearly distinguishable from the Mc1 phenotype, which is far more severe. Therefore, if Mc1 is caused by a misfolded chimeric 16-kDa γ-zein, preventing its expression should restore normal kernel phenotype. Indeed, a simple cross of Mc1 with a maize line carrying the γRNAi transgene produced a non-floury phenotype, providing an example of RNAi as a dominant suppressor of a dominant phenotype and as a general tool in marker rescue.

Analysis of the progeny from the cross of Mc1 and γRNAi mutants:

Mc1 seeds (Stock ID U840I) were requested from the Maize Genetics Cooperation Stock Center. The γRNAi transgenic lines have been reported in previous work (Wu et al. 2010; Wu and Messing 2010). Twelve progeny kernels from the cross of the Mc1 mutant [homozygous for the dominant-negative mutant 16-kDa γ-zein alleles (Δγ16/Δγ16) and heterozygous for the γRNAi line (γRNAi/+)] were dissected at 18 DAP for segregation and mRNA accumulation analyses. For each kernel, the embryo and endosperm were separated for DNA and RNA extraction, respectively. As shown in Figure 1A, five and seven kernels were positive and negative for the amplification of the γRNAi gene with a specific primer set, exemplifying a 1:1 segregation of the γRNAi gene.Open in a separate windowFigure 1.—Segregation analysis of the accumulations of mRNAs and proteins from the cross of the Mc1 mutant and the γRNAi line by RT–PCR and SDS–PAGE. (A) γRNAi gene segregation from progeny (Δγ16/Δγ16 x γRNAi/+) by PCR amplification with a specific primer set (GFPF, ACAACCACTACCTGAGCAC and T35SHindIII, ATTAAGCTTTGCAGGTCACTGGATTTTGG). Kernels 3, 8, 9, 10, and 12 are positive for the γRNAi gene and the rest of them are negative. M, DNA markers from top to bottom band are 3, 2, 1.5, 1.4, and 1 kb. (B) RT–PCR analysis of mRNA accumulation from the normal γ16 and mutant Δγ16 alleles in the endosperms with the genotypes corresponding to the embryos analyzed above. Total RNA was extracted by using TRIzol reagent (Invitrogen). Two micrograms of RNA was digested with DNase I (Invitrogen) and then reverse-transcribed. Twenty-five nanograms of cDNA from each of the twelve endosperms was applied for PCR (25 cycles of 30 sec, 94 °C; 30 sec, 58 °C; and 1 min, 72 °C). A specific primer set (γ16F, ATGAAGGTGCTGATCGTTGC and γ16R, TCAGTAGTAGACACCGCCG) was designed for amplification of the full-length γ16-zein coding sequence (552 bp). The lower band (514 bp) from the mutant Δγ16 allele is 38 bp shorter than that from the normal allele (552 bp). Kernels 3, 8, 9, 10, and 12 with the γRNAi gene accumulated significantly less mRNA compared to those without the γRNAi gene (kernels 1, 2, 4, 5, 6, 7, and 11). BA, hybrid of B × A lines. M, DNA markers from top to bottom are 1 kb, 750 bp, and 500 bp. (C) Profile of zein accumulations of 20 kernels from the progeny as described in the text. The zein extraction method has been described elsewhere (Wu et al. 2009). The Δγ16-zein from Mc1 was not extracted by traditional total-zein extraction protocol (70% ethanol and 2% 2-mercaptoethanol). The γ27- and γ16-zeins were knocked down to a nondetectable level in kernels 1, 2, 3, 5, 7, 10, 12, 13, 16, and 20. In γRNAi-gene segregating progeny (kernels 4, 6, 8, 9, 11, 14, 15, 17, 18, and 19), the γ16-zein from the normal γ16 allele is marked by arrowheads. Protein loaded in each lane was equal to 500 μg fresh endosperm at 18 DAP. The size for each band is indicated by the numbers in the “kDa” columns. BA, hybrid of B × A lines; 1–20, kernels from the progeny described above; M, protein markers from top to bottom are 50, 25, 20, and 15 kDa.Due to the 38-bp deletion in the C terminus of the coding region, the Δγ16 allele is shorter than the normal one (Figure 1B). Therefore, most of Δγ16-zein was in the non-zein fraction. In progeny endosperms of another 20 kernels from the same cross described above segregating for the γRNAi gene, two types of γ16-zeins were synthesized: the normal γ16-zein in the ethanol-soluble zein fraction and the Δγ16-zein in the non-zein fraction. In progeny inheriting the γRNAi gene, the γ27- and γ16-zeins were reduced to nondetectable levels (Figure 1C). Although the Δγ16-zein is not in the ethanol-soluble zein fraction, the level of normal γ16-zein is a good indicator of the accumulation of the Δγ16-zein.

Rescue of protein-body morphologies in the Mc1 mutant:

Regular protein bodies are round with distinct membrane boundaries (Figure 2A) and 1–2 μm in diameter at maturity. In homozygous and heterozygous Mc1 mutants (Δγ16/Δγ16 and Δγ16/+), protein bodies were irregularly shaped, some without discrete boundaries (Figure 2, C and D), which is quite different from the absence of normal γ27- or γ16-zeins in maize endosperm (Figure 2B). Indeed, protein bodies of the Mc1 mutant, blocked in the accumulation of Δγ16-zein, showed morphologies with no discernible difference from those in the γRNAi/+ line (Figure 2, B and E).Open in a separate windowFigure 2.—Transmission electron micrographs of protein bodies. The method has been described elsewhere (Wu and Messing 2010). (A) Nontransgenic BA. (B) γRNAi transgenic line (γRNAi/+). (C) Mc1 (Δγ16/Δγ16). (D) Cross of Mc1 mutant and nontransgenic hybrid of B × A lines (Δγ16/+). (E) Cross of Mc1 mutant (Δγ16/Δγ16) and heterologous γRNAi transgenic line (γRNAi/+). PB, protein body; RER, rough endoplasmic reticulum; CW, cell wall; Mt, mitochondria; SG, starch granule. Bars, 500 nm.

Recovery of floury phenotype in progeny:

On the basis of these observations, it is reasoned that irregularly shaped protein bodies (Figure 2, C and D) in the Mc1 mutant cause the floury phenotype (Figure 3, A and B). Because knockdown of γ-zeins caused opacity only in the crown area (Figure 3C), one could envision that once the irregular protein bodies are restored, the kernel would become vitreous in the gown area of the kernel. Indeed, the progeny ear from the cross of Δγ16/Δγ16 and γRNAi/+ showed a 1:1 ratio of floury and vitreous kernels (Figure 3, D and F), and all kernels were vitreous when the Mc1 mutant was pollinated by a homozygous γRNAi line (Figure 3E).Open in a separate windowFigure 3.—Segregation of vitreous and floury kernels from a progeny ear. (A) Mc1 mutant with Δγ16/Δγ16 genotype. (B) The cross of the Mc1 mutant and the nontransgenic hybrid of B × A lines, showing floury phenotype as in A. (C) γRNAi transgenic line with partial opacity only in the crown area. (D) The cross of the Mc1 mutant (Δγ16/Δγ16) and the heterologous γRNAi transgenic line (γRNAi/+), showing a 1:1 ratio of vitreous and floury kernels. A row in the ear is marked with arrowheads and crosses to indicate vitreous and floury gowns of kernels. (E) Cross of the Mc1 mutant (Δγ16/Δγ16) and the γRNAi homozygous transgenic line (γRNAi/γRNAi), showing all vitreous kernels. (F) Truncated kernel phenotype. (Top) Mc1, cross of Mc1 × BA, and γRNAi transgenic line. (Bottom) Three vitreous and floury kernels from D.

Conclusions:

RNAi can be used to rescue mutations that are dominant negative with a single cross, providing a useful tool in genetic analysis, plant breeding, and potentially in gene therapy in general.