Structure of a ribosomal 5S RNA from a mushroom, Coprinus cinereus

The nucleotide sequence of the 5S rRNA from a mushroom, $\text{Coprinus cinereus}$, was determined to be: pAUCCACGGCCAUACGACUCUGAAAGCACCGCACCGCAUCCCGUCCGAUCUGCGCAGUUAACCAGAGUGCCGCUCAGUUAGUACCACGGUGGGGGACCACGCGGGAAUCCUGGGUGCUGUGGUU. This sequence is consistent with current models for the secondary structure of 5S RNAs and indicates a very high degree of sequence conservation among the most highly evolved fungi. Sequence heterogeneity was not evident in this fungus suggesting that the more highly evolved fungi may not contain the dispersed pattern of 5S rRNA genes which have been observed in intermediate fungi such as $\text{Neurospora}$ (Selker, E.U., and Yanofsky, C. (1981) Cell $\text{24}$, 819–828.)