Detection of Mycobacterium avium subsp. paratuberculosis in Drinking Water and Biofilms by Quantitative PCR

It has been suggested that Mycobacterium avium subspecies paratuberculosis has a role in Crohn''s disease. The organism may be acquired but is difficult to culture from the environment. We describe a quantitative PCR (qPCR) method to detect M. avium subsp. paratuberculosis in drinking water and the results of its application to drinking water and faucet biofilm samples collected in the United States.Mycobacterium avium subspecies paratuberculosis is a member of the Mycobacterium avium complex. M. avium subsp. paratuberculosis causes Johne''s disease in bovine and ovine animals and has been hypothetically linked to Crohn''s disease in humans. Several review articles have been written describing the association between M. avium subsp. paratuberculosis and Crohn''s disease (1, 2, 10, 11, 16, 23). Most mycobacterial infections are acquired from the environment; however, M. avium subsp. paratuberculosis can elude laboratory culture from environmental samples (28). M. avium subsp. paratuberculosis has been cultured only once from drinking water in the United States; therefore, its occurrence in drinking water is unknown (17). There are several reasons one could expect to find M. avium subsp. paratuberculosis in drinking water. The bacterium has been isolated from surface water used as a source of drinking water (19, 20, 24, 26). It is resistant to chlorine disinfection (25). Also, other subspecies of M. avium have been detected in biofilms obtained from drinking water pipes in the United States (8, 22, 27).Due to the potential for waterborne transmission of mycobacteria and the association of M. avium subsp. paratuberculosis with human illness, the focus of this study was to estimate the organism''s occurrence in drinking water in the United States using quantitative PCR (qPCR) (15). A comprehensive method was developed for detection of M. avium subsp. paratuberculosis in drinking water and biofilms that includes the concentration of microorganisms from samples using membrane filtration, total DNA extraction and purification, and detection of two targets unique to this bacterium: IS900 and target 251. IS900 is a common target used to identify M. avium subsp. paratuberculosis, and the average number of copies per genome is 14 to 18 (13). Target 251 qPCR analysis, which corresponds to the M. avium subsp. paratuberculosis gene 2765c (David Alexander, personal communication), was developed by Rajeev et al. (21). Samples positive for both targets are considered positive for M. avium subsp. paratuberculosis. TaqMan primer and probe sequences and qPCR assay characteristics are described in Table ​Table1.1. The complete method is described in Fig. S1 in the supplemental material.

TABLE 1.

qPCR assay primers, probes, DNA targets, and assay characteristics^a

DNA target	Primer or probe (sequence, 5′→3′)	Product (bp)			Reference
			LODb	LOQc
IS900	IS900F (CCGCTAATTGAGAGATGCGATTGG)	230	1.8	1.8	13
	IS900R (ATTCAACTCCAGCAGCGCGGCCTC)
	IS900P (6-FAM-TCCACGCCCGCCCAGACAGG-TAMRA)
Target 251	251F (GCAAGACGTTCATGGGAACT)	200	ND	ND	21
	251R (GCGTAACTCAGCGAACAACA)
	251P (6-FAM-CTGACTTCACGATGCGGTTCTTC-TAMRA)

Open in a separate window^aFAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine; ND, not determined.^bThe limit of detection (LOD) of the IS900 qPCR assay was defined as the lowest copy number resulting in a C_T of <40, determined from six independent dilution series.^cThe limit of quantification (LOQ) was defined as the lowest copy number per assay yielding a coefficient of variation (CV) of less than 25% (33).A master standard curve was generated from six series of 10-fold dilutions of genomic DNA from M. avium subsp. paratuberculosis strain 49164 for quantification of IS900 target copies (see Fig. S2A in the supplemental material). Each dilution series contained eight standards run in triplicate for a total of 18 threshold cycle (C_T) measurements per standard. A linear regression was performed on C_T versus log IS900 copy number and R² was 0.997. The standard error of y was used to create two equations to estimate the upper and lower concentration, or range, of M. avium subsp. paratuberculosis IS900 copy number.The specificities of the IS900 and target 251 primer/probe sets were evaluated by Rajeev et al. (21) on 211 M. avium subsp. paratuberculosis and 38 non-M. avium subsp. paratuberculosis isolates, and each assay was 100% specific for M. avium subsp. paratuberculosis. We further evaluated specificity using 22 M. avium subsp. paratuberculosis isolates from animals and 10 non-M. avium subsp. paratuberculosis ATCC reference strains (see Table S1 in the supplemental material) (18). Target 251 was 100% specific; however, one M. avium subsp. paratuberculosis isolate (3063) repeatedly produced a negative result by IS900 qPCR. Results suggest that a small subset of M. avium subsp. paratuberculosis isolates may not contain the IS900 element or may have a sequence that differs from that of the IS900 primer/probe set.The sensitivity of the method for detection of M. avium subsp. paratuberculosis in different drinking water matrices was evaluated by spiking serial dilutions of strain 1112 cells, ranging from 10⁴ cells to no addition of cells, into 1-liter tap water samples obtained from five locations in the United States. The number of M. avium subsp. paratuberculosis cell equivalents was estimated by dividing the IS900 copy number obtained from the master standard curve by 18 (mean, 18 IS900 copies/M. avium subsp. paratuberculosis genome). The method provided consistent detection (5/5 samples) in a spiked sample of 100 cells/liter. In a spiked sample of 10 cells/liter, the IS900 target was detected 40% (2/5 samples) of the time, and at 1 cell/liter we did not detect the target in any spiked sample. Percent recovery was variable and decreased as the number of spiked cells decreased (Fig. ​(Fig.1).1). At a spike level of 1 × 10⁴ cells/liter, the average percent recovery was 64%; this decreased to 9.2% at 1 × 10² cells/liter. Cell surface hydrophobicity, a property of mycobacteria, may have influenced clumping of the spiked sample or partitioning of M. avium subsp. paratuberculosis onto the sample bottle or filtration unit, affecting recovery of the bacterium (3).Open in a separate windowFIG. 1.Average percent recovery of M. avium subsp. paratuberculosis spiked into drinking water collected from five sites in the United States. Error bars denote standard deviation. MAP, M. avium subsp. paratuberculosis.