排序方式: 共有16条查询结果,搜索用时 15 毫秒
1.
Shu Xu Jianying Luo Xiayan Pan Xiaoyu Liang Jian Wu Wenjun Zheng Changjun Chen Yiping Hou Hongyu Ma Mingguo Zhou 《Biochimica et Biophysica Acta - Proteins and Proteomics》2013,1834(8):1660-1670
The plant-pathogenic bacterium Xanthomonas oryzae pv. oryzae (Xoo) is the causal agent of bacterial blight, which is one of the most serious diseases of rice. Xoo has been studied for over one century, and much has been learned about it, but proteomic investigation has been neglected. In this study, proteome reference maps of Xoo were constructed by two-dimensional gel electrophoresis, and 628 spots in the gels representing 469 different protein species were identified with MALDI-TOF/TOF MS. The identified spots were assigned to 15 functional categories according to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and the annotations from the National Center for Biotechnology Information (NCBI) database. The data set has been deposited in the World-2DPAGE database (Database ID: 0044). In addition, comparative proteomic analysis revealed that proteins related to the TonB-dependent transportation system and energy metabolism are involved in the phenazine-1-carboxylic acid resistance in Xoo. In conclusion, we have established a proteome database for Xoo and have used this database in a comparative proteomic analysis that identified proteins potentially contributing to phenazine-1-carboxylic acid resistance in Xoo. 相似文献
2.
Characterization of the Asia Oceania Human Proteome Organisation Membrane Proteomics Initiative Standard using SDS-PAGE shotgun proteomics 总被引:1,自引:0,他引:1
Although there are now multiple methods for the analysis of membrane proteomes, there is relatively little systematic characterization of proteomic workflows for membrane proteins. The Asia Oceania Human Proteome Organisation (AOHUPO) has therefore embarked on a Membrane Proteomics Initiative (MPI) using a large range of workflows. Here, we describe the characterization of the MPI mouse liver microsomal membrane Standard using SDS-PAGE prior to in-gel tryptic digestion and LC-ESI-MS/MS. The Na(2) CO(3) wash followed by SDS-PAGE prior to in-gel tryptic digestion and LC-MS/MS strategy was effective for the detection of membrane proteins with 47.1% of the identified proteins being transmembrane proteins. Gene Ontology term enrichment analysis showed that biological processes involving transport, lipid metabolism, cell communication, cell adhesion, and cellular component organization were significantly enriched. Comparison of the present data with the previously published reports on mouse liver proteomes confirmed that the MPI Standard provides an excellent resource for the analysis of membrane proteins in the AOHUPO MPI. 相似文献
3.
Multivariate analyses are often used to identify major trends of variation in synonymous codon usage among genes. These analyses need to be performed on properly normalized codon usage data to avoid biases masking this synonymous variation, i.e., gene length, amino acid usage, and codon degeneracy; however, previous studies have failed to do so. In this paper, we demonstrate that the use of alternative normalized data (called 'relative adaptiveness' in the literature) can avoid all these biases and furthermore, can identify more trends of variation among genes, including GC-ending codon usage, GT-ending codon usage, and gene expression level. 相似文献
4.
Mathias RA Chen YS Kapp EA Greening DW Mathivanan S Simpson RJ 《Methods (San Diego, Calif.)》2011,54(4):396-406
Integral membrane proteins (IMPs) mediate several cellular functions including cell adhesion, ion and nutrient transport, and cell signalling. IMPs are typically hard to isolate and purify due to their hydrophobic nature and low cellular abundance, however, microsomes are small lipid vesicles rich in IMPs, which form spontaneously when cells are mechanically disrupted. In this study, we have employed mouse liver microsomes as a model for optimising a method for IMP isolation and characterisation. Microsomes were collected by differential centrifugation, purified with sodium carbonate, and subjected to GeLC–MS/MS analysis. A total of 1124 proteins were identified in the microsome fraction, with 47% (524/1124) predicted by TMHMM to contain at least one transmembrane domain (TMD). The ability of phase partitioning using the detergent Triton X-114 (TX-114) to further enrich for membrane proteins was evaluated. Microsomes were subjected to successive rounds of solubility-based phase separation, with proteins partitioning into the aqueous phase, detergent phase, or TX-114-insoluble pellet fraction. GeLC–MS/MS analysis of the three TX-114 fractions identified 1212 proteins, of which 146 were not detected in the un-fractionated microsome sample. Conspicuously, IMPs partitioned to the detergent phase, with 56% (435/770) of proteins identified in that fraction containing at least one TMD. GO Slim characterisation of the microsome proteome revealed enrichment of proteins from the endoplasmic reticulum, mitochondria, Golgi apparatus, endosome, and cytoplasm. Further, enzymes including monooxygenases were well represented with 35 cytochrome P450 identifications (CYPs 1A2, 2A5, 2A12, 2B10, 2C29, 2C37, 2C39, 2C44, 2C50, 2C54. 2C67, 2C68, 2C70, 2D10, 2D11, 2D22, 2D26, 2D9, 2E1, 2F2, 2J5, 2U1, 3A11, 3A13, 3A25, 4A10, 4A12A, 4A12B, 4F13, 4F14, 4F15, 4V3, 51,7B1, and 8B1). Evaluation of biological processes showed enrichment of proteins involved in fatty acid biosynthesis and elongation, as well as steroid synthesis. In addition, transport proteins including 24 members of the Rab family of GTPases were identified. Comparison of this dataset with the current mouse liver microsome proteome contributes an additional 648 protein identifications, of which 50% (326/648) contain at least one TMD. 相似文献
5.
In the present study, major constraints for codon and amino acid usage of Sulfolobus acidocaldarius, Sulfolobus solfataricus, Sulfolobus tokodali, Sulfolobus islandis and 6 other isolates from islandicus species of genus Sulfolobus were investigated. Correspondence analysis revealed high significant correlation between the major trend of synonymous codon usage and gene expression level, as assessed by the “Codon Adaptation Index” (CAI). There is a significant negative correlation between Nc (Effective number of codons) and CAI demonstrating role of codon bias as an important determinant of codon usage. The significant correlation between major trend of synonymous codon usage and GC3s (G + C at third synonymous position) indicated dominant role of mutational bias in codon usage pattern. The result was further supported from SCUO (synonymous codon usage order) analysis. The amino acid usage was found to be significantly influenced by aromaticity and hydrophobicity of proteins. However, translational selection which causes a preference for codons that are most rapidly translated by current tRNA with multiple copy numbers was not found to be highly dominating for all studied isolates. Notably, 26 codons that were found to be optimally used by genes of S. acidocaldarius at higher expression level and its comparative analysis with 9 other isolates may provide some useful clues for further in vivo genetic studies on this genus. 相似文献
6.
Hydrophilins are a group of proteins that are present in all organisms and that have been defined as being highly hydrophilic and rich in glycine. They are assumed to play important roles in cellular dehydration tolerance. There are 12 genes in the yeast Saccharomyces cerevisiae that encode hydrophilins and most of these genes are stress responsive. However, the functional role of yeast hydrophilins, especially in desiccation and freezing tolerance, is largely unknown. Here, we selected six candidate hydrophilins for further analysis. All six proteins were predicted to be intrinsically disordered, i.e. to have no stable structure in solution. The contribution of these proteins to the desiccation and freezing tolerance of yeast was investigated in the respective knock-out strains. Only the disruption of the genes YJL144W and YMR175W (SIP18) resulted in significantly reduced desiccation tolerance, while none of the strains was affected in its freezing tolerance under our experimental conditions. Complementation experiments showed that yeast cells overexpressing these two genes were both more desiccation and freezing tolerant, confirming the role of these two hydrophilins in yeast dehydration stress tolerance. 相似文献
7.
An extensive analysis of C. dubliniensis proteomics data showed that ~ 22% protein are conserved hypothetical proteins (HPs) whose function is still not determined precisely. Analysis of gene sequence of HPs provides a platform to establish sequence–function relationships to a more profound understanding of the molecular machinery of organisms at systems level. Here we have combined the latest versions of bioinformatics tools including, protein family, motifs, intrinsic features from the amino acid sequence, sequence–function relationship, pathway analysis, etc. to assign a precise function to HPs for which no any experimental information is available. Our results show that 27 HPs have well defined functions and we categorized them as enzyme, nucleic acid binding, transport protein, etc. Five HPs showed adhesin character that is likely to be essential for the survival of yeast and pathogenesis. We also addressed issues related to the sub-cellular localization and signal peptide identification which provides an idea about its colocalization and function. The outcome of the present study may facilitate better understanding of mechanism of virulence, drug resistance, pathogenesis, adaptability to host, tolerance for host immune response, and drug discovery for treatment of C. dubliniensis infections. 相似文献
8.
R. Shyama Prasad Rao Ian Max Møller 《Biochimica et Biophysica Acta - Proteins and Proteomics》2012,1824(3):405-412
Many recent high throughput technologies have enabled large-scale discoveries of new phosphorylation sites and phosphoproteins. Although they have provided a number of insights into protein phosphorylation and the related processes, an inclusive analysis on the nature of phosphorylated sites in proteins is currently lacking. We have therefore analyzed the occurrence and occupancy of phosphorylated sites (~ 100,281) in a large set of eukaryotic proteins (~ 22,995). Phosphorylation probability was found to be much higher in both the termini of protein sequences and this is much pronounced in transmembrane proteins. A large proportion (51.3%) of occupied sites had a nearby phosphorylation within a distance of 10 amino acids; however, this proportion is very high compared to the expected one (16.9%). The distribution of phosphorylated sites in proteins showed a strong deviation from the expected maximum randomness. An analysis of phosphorylation motifs indicated that just 40 motifs and a much lower number of associated kinases might account for nearly 50% of the known phosphorylations in eukaryotic proteins. Our results provide a broad picture of the phosphorylation sites in eukaryotic proteins. 相似文献
9.
Hua Wang Yan Fang Zhongzan Bao Xing Jin Wenjuan Zhu Lipeng Wang Teng Liu Haipeng Ji Haiying Wang Shiqing Xu Yanghu Sima 《Gene》2014
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress. 相似文献
10.
Recombinant analogs of spider dragline silk proteins 1F9 and 2E12 are characterized by numerous repeats consisting of hydrophobic poly-Ala blocks and Gly-rich sequences with a substantial number of positively charged amino acid residues which suggest a pronounced ability to interact with negatively charged phospholipid membranes. Actually both proteins displayed substantial binding affinity towards lipid vesicles formed of acidic lipids as measured by fluorescence correlation spectroscopy (FCS) using rhodamine-labeled conjugates of the proteins. Both proteins did not induce liposome leakage, fusion or breakdown, but were able to bring about liposome aggregation. 1F9 was more active in the induction of liposome aggregation compared to 2E12. Interestingly, 2E12 markedly decreased the rate of calcium-induced liposome fusion. Circular dichroism data showed that binding of the proteins to negatively charged phosphatidylserine liposomes provoked transition from the left-handed helix of polyproline II (PPII) type to β-structures and α-helices. The data suggested predominantly surface location of membrane bound proteins without significant perturbation of their hydrophobic core. 相似文献