Cultivation of the sapropelic ciliate Plagiopyla nasuta Stein and isolation of the endosymbiont Methanobacterium formicicum

The sapropelic ciliate Plagiopyla nasuta was isolated and cultured in monoculture. Optimal conditions for growth were: 15–20°C, pH about 7, and about 2% of oxygen in the headspace. Cultures of P. nasuta produced methane. Epifluorescence microscopy revealed the presence of methanogenic bacteria as endosymbionts. An endosymbiont of the ciliate was isolated and identified as Methanobacterium formicicum. In the ciliate cell these methanogens were found to be closely associated with microbody-like organelles. No mitochondria could be detected.     

Free-radical-induced mutation vs redox regulation: Costs and benefits of genes in organelles

The prokaryotic endosymbionts that became plastids and mitochondria contained genes destined for one of three fates. Genes required for free-living existence were lost. Most genes useful to the symbiosis were transferred to the nucleus of the host. Some genes, a small minority, were retained within the organelle. Here we suggest that a selective advantage of movement of genes to the nucleus is decreased mutation: plastids and mitochondria have high volume-specific rates of redox reactions, producing oxygen free radicals that chemically modify DNA. These mutations lead to synthesis of modified electron carriers that in turn generate more mutagenic free radicals—the “vicious circle” theory of aging. Transfer of genes to the nucleus is also advantageous in facilitating sexual recombination and DNA repair. For genes encoding certain key components of photosynthesis and respiration, direct control of gene expression by redox state of electron carriers may be required to minimize free radical production, providing a selective advantage of organelle location which outweighs that of location in the nucleus. A previous proposal for transfer of genes to the nucleus is an economy of resources in having a single genome and a single apparatus for gene expression, but this argument fails if any organellar gene is retained. A previous proposal for the retention of genes within organelles is that certain proteins are organelle-encoded because they cannot be imported, but there is now evidence against this view. Decreased free radical mutagenesis and increased sexual recombination upon transfer to the nucleus together with redox control of gene expression in organelles may now account for the slightly different gene distributions among nuclei, plastids, and mitochondria found in major eukaryote taxa. This analysis suggests a novel reason for uniparental inheritance of organelles and the evolution of anisogametic sex, and may also account for the occurrence of nitrogen fixation in symbionts rather than in nitrogen-fixing organelles. Correspondence to: J.F. Allen     

Studies on initiation and development of the partner association inGeosiphon pyriforme (Kütz.) v. Wettstein,a unique endocytobiotic system of a fungus (Glomales) and the cyanobacteriumNostoc punctiforme (Kütz.) Hariot

Summary Phagocytosis ofNostoc filaments byGeosiphon, a fungus closely related to AM forming Glomales, was observed under light microscopes. Incorporation can only be performed ifNostoc primordia come into contact with growing hyphal tips of the fungus. The fungal wall just below the apex softens, and fungal cytoplasm is bulged out repeatedly covering the vegetativeNostoc cells but not the heterocytes. New heterocytes are differentiated by the internalised filament whose cells can increase up to ten times in volume after recovering from incorporation strain. TheNostoc cells are coated stepwise by short finger-shaped protuberances of the fungal hypha. These hernia-like outgrowths first remain separated, after 1 to 2 days they merge. Adjacent hyphal walls inside the complex covering disintegrate. Periphal fungal wall portions are united to form a smooth strong outer envelope. Internalisation is categorised as phagocytosis. The partnership is partly specific,Nostoc strains capable of living endocytobiotically are often partners in other symbioses besidesGeosiphon.Abbreviations AM arbuscular mycorrhiza (formerly VAM vesicular arbuscular mycorrhiza) - DIC differential interference contrast - LD light/dark Dedicated to Prof. Dr. Dr. h.c. Eberhard Schnepf on the occasion of his retirement     

Occurrence of Chaperonin 60 and Chaperonin 10 in primary and secondary bacterial symbionts of aphids: Implications for the evolution of an endosymbiotic system in aphids

Summary All aphids harbor symbiotrophic prokaryotes (primary symbionts) in a specialized-abdominal cell, the bacteriocyte. Chaperonin 60 (Cpn60, symbionin) and chaperonin 10 (Cpn10), which are high and low molecular weight heatshock proteins, were sought in tissues of more than 60 aphid species. The endosymbionts were compared immunologically and histologically. It was demonstrated that (1) there are two types of aphids in terms of the endosymbiotic system: some with only primary symbionts and others with, in addition, secondary symbionts; (2) the primary symbionts of various aphids are quite similar in morphology whereas the secondary symbionts vary; and (3) irrespective of the aphid species, Cpn60 is abundant in both the primary and secondary symbionts, while Cpn10 is abundant in the secondary symbionts but present in small amounts in the primary ones. Based on these results, we suggest that the primary symbionts have been derived from a prokaryote that was acquired by the common ancestor of aphids whereas the secondary symbionts have been acquired by various aphids independently after divergence of the aphid species. In addition, we point out the possibility that the prokaryotes under intracellular conditions have been subject to some common evolutionary pressures, and as a result, have come to resemble cell organelles.     

On the developmental dependence between Cyanophora paradoxa and Cyanocyta korschikoffiana in symbiosis

The prokaryote Cyanocyta korschikoffiana was isolated from the eukaryote Cyanophora paradoxa. The synthesis of several thylakoid proteins in these cyanelles is influenced by light and darkness and is sensitive to cycloheximide, the inhibitor of the eukaryotic host's translation. The possibility of a direct coordination between the translations of the host and of the cyanelles is discussed.Abbreviations CHM treatment addition of cycloheximide - CPN chlorophylline - PBN phycobiline - SDS-PAGE sodium-dodecylsulphate-polyacrylamide gelelectrophoresis     

Photobehaviour of Paramecium bursaria infected with different symbiotic and aposymbiotic species of Chlorella

The endosymbiotic unit of Paramecium bursaria and Chlorella spec. shows two types of photobehaviour: 1) A step-up photophobic response which possibly depends on photosensitive agents in the ciliate cell itself — as is also shown by alga-free Paramecium bursaria - and can be drastically enhanced by photosynthetic activity of symbiotic algae; and 2) a step-down photophobic response. The step-down response leads to photoaccumulation of green paramecia. Both types of photobehaviour in Paramecium bursaria do not depend on any special kind of algal partners: The infection of alga-free Paramecium bursaria with different Chlorella species results in new ciliatealgae-associations. They are formed not only by combination of the original symbiotic algae with their host, but also by infection with other symbiotic or free-living (aposymbiotic) chlorellae, respecitively. Systems with other than the original algae are not permanently stable — algae are lost under stress conditions — but show the same types of photobehaviour. Photoaccumulation in general requires algal photosynthesis and occurs only with ciliates containing more than fifty algae/cell. It is not mediated by a chemotactic response to oxygen in the medium, since it occurs at light fluence rates not sufficient for a release of oxygen by the symbiotic system, e.g., below its photosynthetic compensation point. Photoresponses can be inhibited by 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU). Sensory transduction does not depend on any special symbiotic features of the algae, e.g., sugar excretion. The participation of oxygen in the Paramecium cell, of its cytoplasmic pH and of ions released or taken up by endosymbiotic algae in sensory transduction is discussed.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Geosiphon pyriforme,an Endosymbiotic Consortium of a Fungus and a Cyanobacterium (Nostoc), Fixes Nitrogen

The bladders of Geosiphon pyriforme, an endosymbiotic consortium of a fungus and the cyanobacterium Nostoc punctiforme, show nitrogenase activity. This suggests that the organism is capable of nitrogen fixation.     

On the origin of mitochondria: a reexamination of the molecular structure and kinetic properties of pyruvate dehydrogenase complex from brewer''s yeast

45Ca2+ incorporated in response to glucose was selectively mobilized from the beta-cell-rich pancreatic islets of ob/ob-mice after raising the intracellular Na+ by removal of K+ or addition of ouabain or veratridine. Also studies of insulin release indicated opposite effects of glucose and Na+ on the intracellular sequestration of calcium. The fact that glucose inhibits insulin release induced by raised intracellular Na+ indicates that this sugar can lower the cytoplasmic [Ca2+]. The concept of a dual action of glucose on the cytoplasmic [Ca2+]. The concept of a dual action of glucose on the cytoplasmic [Ca2+] might well explain previous observations of an inhibitory component in the glucose action on the 45Ca2+ efflux.