Ecology of Endomycorrhizal Association in Musa spp. of South India

This is the first report of a comprehensive ecological investigation of AMF symbiosis in banana over a very broad zone of its commercial cultivation, South India. The AMF characteristics in relation to specific banana varieties, soils and seasons are carried out. This baseline data has global use for mycorrhizal applications in the crop. Spore density and percentage root colonization in relation to soil fertility parameters, seasons and soil series, along with other ecological parameters are assessed as per standard methods. Altogether 14 different AMF species of 13 different banana varieties, in terms of spore density and percentage colonization from 47 different soil series of South India are discovered. Among the 14 AMF species observed, Dentiscutata nigra is a new report in banana. Shannon’s diversity index and Simpson’s index over seasons are measured. Evenness in AM fungal population in banana fields in the monsoon was higher than that of summer. Presence of over 30% AMF root colonization in majority of banana varieties revealed its significance in the crop.     

Biophysical characterization of DNA and RNA aptamer interactions with hen egg lysozyme

This work characterized the binding of an RNA aptamer recognizing hen egg white lysozyme, as well as a literature-reported single-stranded DNA analog of sequence identical to the original RNA aptamer, using fluorescence anisotropy, isothermal titration calorimetry (ITC) and analytical ultracentrifugation. The polyanionic DNA aptamer analog is selective for lysozyme even over cationic cytochrome c and has been reported to be successfully used in biosensing applications. The association however, is predominantly of electrostatic character, strongly salt-sensitive and entropically-driven, in contrast to previously described enthalpically-driven antibody-lysozyme and DNA aptamer-VEGF interactions. With a moderate selectivity for their target, high salt-sensitivity along with fast association and dissociation behavior, these molecules might serve as pseudo-affinity ligands for biomolecular separations.     

Sulfur oxidation by the cyanide-degrading fungusRhizopus oryzae

The cyanide-degrading fungusRhizopus oryzae associated with post-harvest spoilage of cassava (Manihot esculenta L.) oxidized S⁰ to S₂O₃ ²⁻, S₄O₆ ²⁻ and SO₄ ²⁻ in culture and when grown in autoclaved soil amended with S⁰. Oxidation of sulfur was associated with rhodanese activity of the fungus.     

Mapping discontinuous protein‐binding sites via structure‐based peptide libraries: combining in silico and in vitro approaches

To perform their various functions, protein surfaces often have to interact with each other in a specific way. Usually, only parts of a protein are accessible and can act as binding sites. Because proteins consist of polypeptide chains that fold into complex three‐dimensional shapes, binding sites can be divided into two different types: linear sites that follow the primary amino acid sequence and discontinuous binding sites, which are made up of short peptide fragments that are adjacent in spatial proximity. Such discontinuous binding sites dominate protein–protein interactions, but are difficult to identify. To meet this challenge, we combined a computational, structure‐based approach and an experimental, high‐throughput method. SUPERFICIAL is a program that uses protein structures as input and generates peptide libraries to represent the protein's surface. A large number of the predicted peptides can be simultaneously synthesised applying the SPOT technology. The results of a binding assay subsequently help to elucidate protein–protein interactions; the approach is applicable to any kind of protein. The crystal structure of the complex of hen egg lysozyme with the well‐characterised murine IgG1 antibody HyHEL‐5 is available, and the complex is known to have a discontinuous binding site. Using SUPERFICIAL, the entire surface of lysozyme was translated into a peptide library that was synthesised on a cellulose membrane using the SPOT technology and tested against the HyHEL‐5 antibody. In this way, it was possible to identify two peptides (longest common sequence and peptide 19) that represented the discontinuous epitope of lysozyme. Copyright © 2012 John Wiley & Sons, Ltd.     

The effect of antiapoptosis genes on clarification performance

Optimal bioreactor harvest time is typically determined based on maximizing product titer without compromising product quality. We suggest that ease of downstream purification should also be considered during harvest. In this view, we studied the effect of antiapoptosis genes on downstream performance. Our hypothesis was that more robust cells would exhibit less cell lysis and thus generate lower levels of cell debris and host‐cell contaminants. We focused on the clarification unit operation, measuring postclarification turbidity and host‐cell protein (HCP) concentration as a function of bioreactor harvest time/cell viability. In order to mimic primary clarification using disk‐stack centrifugation, a scale‐down model consisting of a rotating disk (to simulate shear in the inlet feed zone of the centrifuge) and a swinging‐bucket lab centrifuge was used. Our data suggest that in the absence of shear during primary clarification (typical of depth filters), a 20–50% reduction in HCP levels and 50–65% lower postcentrifugation turbidity was observed for cells with antiapoptosis genes compared to control cells. However, on exposing the cells to shear levels typical in a disk‐stack centrifuge, the reduction in HCP was 10–15% while no difference in postcentrifugation turbidity was observed. The maximum benefit of antiapoptosis genes is, therefore, realized using clarification options that involve low shear, <1 × 10⁶ W/m³ and minimal damage to the cells. © 2013 American Institute of Chemical Engineers Biotechnol. Prog., 30:100–107, 2014     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Biogeochemical indicators of environmental changes from 50 Ka to 10 Ka in a humid region of the Brazilian Amazon

We present a geochemical record of a 113.6-cm sediment core (LPT V) from Lagoa da Pata, which is located in the forested upper Rio Negro basin. The record reveals significant changes in the environmental history of Amazonia during the late Quaternary. The results of biogeochemical analyses revealed three hydrological and climatic regimes from 50,000 to 10,000 cal yr BP. The first phase, between 50,000 and 26,300 cal yr BP, was characterized by a relatively wet climate as suggested by relatively high total organic carbon (TOC) and chlorophyll derivate concentrations, indicating high productivity linked to a high lake level. A decrease of the TOC and chlorophyll derivate accumulation rates between 43,100 cal yr BP and 26,300 cal yr BP marks a decrease in the productivity linked to a reduced lake level, indicating a decrease in moisture at the end of this phase. The second phase, between 26,300 and 15,300 cal yr BP, was characterized by a decrease in productivity, reaching a minimum at 21,950 cal yr BP, as indicated by a minima in sedimentary chlorophyll and TOC accumulation rates. Values of δ¹³C increased by 5‰ in relation to the preceding phase, indicating an influence of the C₄ organic matter. High iron concentrations and accumulation rates, related to intense erosion of the lateritic crust in the watershed, were observed. All of the observations indicate a dry phase during this period. A third phase, from approximately 15,300 to 10,000 cal yr BP, was characterized by an increase in lacustrine productivity, as shown by an increased in TOC and chlorophyll derivate concentrations and accumulation rates. These increases likely correspond to a lake level rise due to a wetter climate.     

Wide Band Gap Al and In Co-doped ZnO Films for Near-Infrared Plasmonic Application

In transparent conducting oxide films, tuning of plasmonic resonance is directly controlled by free electron concentration and thus by activated dopants. In this study, large area Al_xIn_yZn_1-x-yO thin films at various concentrations were prepared by spray coating using water as a solvent. The effect of Al/In dopant ratio on the structural, electrical, optical, and plasmonic properties was investigated. Tuning of optical response to a well-defined plasmon resonance is correlated to the above properties of Al_xIn_yZn_1-x-yO films. Theoretical fitting based on the Drude-Lorentz (D-L) theory was utilized for extracting the dielectric spectra and cross-over wavelength (ω_c). The studies revealed plasmonic properties in NIR for the films with Al/In ratios of A₅I₅, A_2.5I_7.5, and A₀I₁₀, indicating In as the most activated dopant. Surface plasmon mode simulated using the extracted permittivity values showed the influence of mobility of these films on the broadening of the dip. The minimum plasmonic loss suggests the suitability as an alternative plasmonic material in the near infrared.