排序方式: 共有75条查询结果,搜索用时 234 毫秒
1.
Hong Wang Urmila Sreenivasan Da-Wei Gong Kelly A. O'Connell Erinne R. Dabkowski Peter A. Hecker Nicoleta Ionica Manige Konig Anup Mahurkar Yezhou Sun William C. Stanley Carole Sztalryd 《Journal of lipid research》2013,54(4):953-965
Presence of ectopic lipid droplets (LDs) in cardiac muscle is associated to lipotoxicity and tissue dysfunction. However, presence of LDs in heart is also observed in physiological conditions, such as when cellular energy needs and energy production from mitochondria fatty acid β-oxidation are high (fasting). This suggests that development of tissue lipotoxicity and dysfunction is not simply due to the presence of LDs in cardiac muscle but due at least in part to alterations in LD function. To examine the function of cardiac LDs, we obtained transgenic mice with heart-specific perilipin 5 (Plin5) overexpression (MHC-Plin5), a member of the perilipin protein family. Hearts from MHC-Plin5 mice expressed at least 4-fold higher levels of plin5 and exhibited a 3.5-fold increase in triglyceride content versus nontransgenic littermates. Chronic cardiac excess of LDs was found to result in mild heart dysfunction with decreased expression of peroxisome proliferator-activated receptor (PPAR)α target genes, decreased mitochondria function, and left ventricular concentric hypertrophia. Lack of more severe heart function complications may have been prevented by a strong increased expression of oxidative-induced genes via NF-E2-related factor 2 antioxidative pathway. Perilipin 5 regulates the formation and stabilization of cardiac LDs, and it promotes cardiac steatosis without major heart function impairment. 相似文献
2.
3.
Urmila Saha Asma Yasmeen Khan Sutanwi Bhuiya Suman Das Gaetano Fiorillo Paolo Lombardi 《Journal of biomolecular structure & dynamics》2019,37(6):1375-1389
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M?1, and that of BER was (0.98 ± 0.03) × 105 M?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands. 相似文献
4.
5.
Tawar U Jain AK Chandra R Singh Y Dwarakanath BS Chaudhury NK Good L Tandon V 《Biochemistry》2003,42(45):13339-13346
DNA minor groove ligands provide a paradigm for double-stranded DNA recognition, where common structural motifs provide a crescent shape that matches the helix turn. Since minor groove ligands are useful in medicine, new ligands with improved binding properties based on the structural information about DNA-ligand complexes could be useful in developing new drugs. Here, two new synthetic analogues of AT specific Hoechst 33258 5-(4-methylpiperazin-1-yl)-2-[2'-(3,4-dimethoxyphenyl)-5'-benzimidazolyl] benzimidazole (DMA) and 5-(4-methylpiperazin-1-yl)-2-[2'[2'-(4-hydroxy-3-methoxyphenyl)-5' '-benzimidazolyl]-5'-benzimidazolyl] benzimidazole (TBZ) were evaluated for their DNA binding properties. Both analogues are bisubstituted on the phenyl ring. DMA contains two ortho positioned methoxy groups, and TBZ contains a phenolic group at C-4 and a methoxy group at C-3. Fluorescence yield upon DNA binding increased 100-fold for TBZ and 16-fold for DMA. Like the parent compound, the new ligands showed low affinity to GC-rich (K approximately 4 x 10(7) M(-1)) relative to AT-rich sequences (K approximately 5 x 10(8) M(-1)), and fluorescence lifetime and anisotropy studies suggest two distinct DNA-ligand complexes. Binding studies indicate expanded sequence recognition for TBZ (8-10 AT base pairs) and tighter binding (DeltaT(m) of 23 degrees C for d (GA(5)T(5)C). Finally, EMSA and equilibrium binding titration studies indicate that TBZ preferentially binds highly hydrated duplex domains with altered A-tract conformations d (GA(4)T(4)C)(2) (K= 3.55 x 10(9) M(-1)) and alters its structure over d (GT(4)A(4)C)(2) (K = 3.3 x 10(8) M(-1)) sequences. Altered DNA structure and higher fluorescence output for the bound fluorophore are consistent with adaptive binding and a constrained final complex. Therefore, the new ligands provide increased sequence and structure selective recognition and enhanced fluorescence upon minor groove binding, features that can be useful for further development as probes for chromatin structure stability. 相似文献
6.
Smith KR Uyeminami DL Kodavanti UP Crapo JD Chang LY Pinkerton KE 《Free radical biology & medicine》2002,33(8):1106-1114
Cigarette smokers experience airway inflammation and epithelial damage, the mechanisms of which are unknown. One potential cause may be free radicals either in tobacco smoke or produced during persistent inflammation. Inflammation may also be a driving force to cause airway epithelium to undergo changes leading to squamous cell metaplasia. To test whether tobacco smoke-induced inflammation could be reduced by a catalytic antioxidant, manganese(III)meso-tetrakis(N,N'-diethyl-1,3-imidazolium-2-yl) porphyrin (AEOL 10150) was given by intratracheal instillation to rats exposed to filtered air or tobacco smoke. Exposure to tobacco smoke for 2 d or 8 weeks (6 h/d, 3 d/week) significantly increased the number of cells recovered by bronchoalveolar lavage (BAL). AEOL 10150 significantly decreased BAL cell number in tobacco smoke-treated rats. Significant reductions in neutrophils were noted at 2 d and macrophages at 8 weeks. Lymphocytes were significantly reduced by AEOL 10150 at both time points. Squamous cell metaplasia following 8 weeks of tobacco smoke exposure was 12% of the total airway epithelial area in animals exposed to tobacco smoke without AEOL 10150, compared with 2% in animals exposed to tobacco smoke, but treated with AEOL 10150 (p <.05). We conclude that a synthetic catalytic antioxidant decreased the adverse effects of exposure to tobacco smoke. 相似文献
7.
Expression of progesterone receptor (PR) localization on spermatozoa was determined in men with normal and abnormal spermiograms. Studies were also carried out to evaluate the potential of PR as a marker of sperm function. Progesterone receptor expression on spermatozoa from men with normozoospermia (n = 8), oligozoospermia (n = 7), asthenozoospermia (n = 8), oligoasthenozoospermia (n = 7), and teratozoospermia (n = 11) was analyzed using an immunocytochemical method with monoclonal antibodies against PR, and flow cytometry using a cell-impermeable fluorescein-tagged progesterone coupled to BSA complex (P-FITC-BSA). Both methods revealed significantly fewer (P < 0.05) PR-positive spermatozoa in men with oligozoospermia, asthenozoospermia, oligoasthenozoospermia, and teratozoospermia compared with men with normozoospermia, thereby suggesting that down-regulation of PR expression in spermatozoa may be one of the causes of male infertility. Spermatozoa from men with normozoospermia (n = 12), oligozoospermia (n = 12), asthenozoospermia (n = 12), oligoasthenozoospermia (n = 9), and teratozoospermia (n = 10) were exposed to low osmotic conditions in the hypoosmotic swelling (HOS) test and then analyzed for PR expression using P-FITC-BSA complex. A significantly higher percentage (P < 0.05) of spermatozoa with physiologically active plasma membrane (HOS+) lacked PR expression (HOS+PR-) in all categories of men with infertility, thereby suggesting that compared to the HOS test, PR expression is a better indicator of sperm function. Furthermore, PR expression in spermatozoa showed a strong (P < 0.05) positive correlation with their ability to undergo an in vitro acrosome reaction. This was observed in all study groups (i.e., normozoospermia, r = 0.8545; oligozoospermia, r = 0.8711; asthenozoospermia, r = 0.7645; oligoasthenozoospermia, r = 0.9003; and teratozoospermia, r = 0.8676). This suggests a potential role for PR in the events leading to the acrosome reaction in sperm. 相似文献
8.
Locking and unlocking of ribosomal motions 总被引:20,自引:0,他引:20
During the ribosomal translocation, the binding of elongation factor G (EF-G) to the pretranslocational ribosome leads to a ratchet-like rotation of the 30S subunit relative to the 50S subunit in the direction of the mRNA movement. By means of cryo-electron microscopy we observe that this rotation is accompanied by a 20 A movement of the L1 stalk of the 50S subunit, implying that this region is involved in the translocation of deacylated tRNAs from the P to the E site. These ribosomal motions can occur only when the P-site tRNA is deacylated. Prior to peptidyl-transfer to the A-site tRNA or peptide removal, the presence of the charged P-site tRNA locks the ribosome and prohibits both of these motions. 相似文献
9.
Effect of chromium picolinate on histopathological alterations in STZ and neonatal STZ diabetic rats
Earlier studies from our laboratory have indicated insulin sensitizing action of chromium picolinate as the mechanism of its anti-diabetic activity in experimental models of type I and type II diabetes. In the present investigation, we have evaluated the effects of chronic administration of chromium picolinate on the functional and histological alterations of streptozotocin (STZ)-induced diabetes in rats. Type I diabetes was induced by intravenous injection of STZ (40 mg/kg) in adult rats, whereas, type II diabetes was induced by intraperitoneal injection of STZ (90 mg/kg) in 2-day old rat pups which in adulthood develop abnormalities resembling type II diabetes. Chromium picolinate was administered at 8 μg/ml in drinking water for 6 weeks and was found to improve glucose tolerance and increase insulin sensitivity of STZ-diabetic rats. This treatment decrease elevated serum creatinine and urea levels as well as elevated serum levels of hepatic enzymes of both groups of diabetic rats. Histopathological studies of kidney and liver show decrease in the intensity and incidence of vacuolations, cellular infiltration and hypertrophy of STZ and nSTZ (neonatal STZ) diabetic rats. Chronic treatment with chromium picolinate however, did not alter the normal function or morphology of control rats. Chronic chromium picolinate at the therapeutic doses that improved glucose tolerance, was observed to have no hepatotoxic or nephrotoxic potential. It was rather found to improve renal and hepatic function and to reduce abnormalities associated with STZ-diabetes. Chromium picolinate could play an important role in the long term management of diabetes mellitus. 相似文献
10.
False smut is a disease of rice inflorescence. The existing systems of disease severity assessment for rice false smut disease are not very sensitive as the ball quality and also the impact of false smut on filled grain number and grain‐filling were not under consideration. Here, a precise assessment method to evaluate the severity of the disease was developed. The ‘yield representative’ (YR) based on ‘mean floret wt.’ and ‘filled grain %’ was simulated for the precise disease severity assessment of rice false smut disease. The single floret weight envisages major yield components irrespective of the type of panicle. Correlation between YR and major yield attributes was studied, and it was observed that YR had significant correlation with ‘filled grain %’ (0.77–0.95) and ‘single spikelet weight’ (0.88–0.98). Significant negative correlation of YR was observed with the chaff percentage, false smut ball number and ball weight. This YR‐based methodology was utilized to assess the disease severity in nine rice cultivars. The disease severity in those nine cultivars was evaluated by the already existing methodologies also. The disease severity measured by the present technique was compared with the disease severity assessed by the old methodologies. The procedure adapted here for disease severity measurement was found to be more informative and useful. It was observed that in case of mild infection, the false smut was enhancing yield attributes. The high‐yielding rice varieties Savitri and Gayatri were found to be tolerant to false smut and may be used as resistant donors. 相似文献