Enzyme distributions in subcellular fractions of BHK cells infected with Semliki forest virus: evidence for a major fraction of sphingomyelin synthase in the trans-golgi network.

BHK cells either untreated or infected with Semliki Forest virus have been fractionated on sucrose density gradients. Virus infection caused an increase in density of a membrane fraction enriched in sphingomyelin (SM), cholesterol, SM synthase and sialyltransferase activity. This increase in density was related to incorporation of viral proteins into this fraction, which is likely to contain trans-Golgi network (TGN) membranes. In contrast, glucosylceramide synthase and galactosyltransferase activities (markers for cis/medial and trans-Golgi respectively) underwent no density shift and alkaline phosphodiesterase, a plasma membrane marker, was only slightly density-shifted in infected cells. When cells were incubated with NBD-ceramide to enable them to synthesise NBD-SM and then washed with albumin to remove surface label, fluorescence in untreated cells was concentrated in a single juxtanuclear spot but in infected cells this region of bright fluorescence was larger and extended around the nucleus. After fractionation of these cells, NBD-SM (but only a small proportion of the NBD-ceramide) was found to be shifted into the higher density fraction in infected cells. This work provides further evidence that SM synthase is not mainly localised in the early Golgi cisternae as previously thought, but is associated more with a cholesterol-rich compartment which could be the TGN.     

Plating Medium for Differentiating Salmonella arizonae from Other Salmonellae

A differential plating medium developed for isolation of Salmonella arizonae produces a uniform reaction for both lactose-negative and -positive S. arizonae and differentiates S. arizonae from other salmonellae.     

A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites

Restriction fragment length polymorphisms (RFLPs) were described for the porcine loci for β-glucosidase (GBA) and the β-polypeptide 1 of the Na⁺, K⁺-transporting ATPase (ATP1B1). Linkage analyses using a three-generation pedigree provided evidence for the assignment of ATP1B1, GBA and two microsatellite loci (S0001 and S0067) to a previously described linkage group comprising the loci for blood group L (EAL) and an anonymous microsatellite (S0097). The linear order of the six markers was determined with confidence by multipoint analyses and the length of the linkage group was estimated at 88 CM. This linkage group was assigned to pig chromosome 4 on the basis of a previous physical localization of the ATP1B1 gene. In situ hybridization data for S0001 presented in this study were consistent with a localization on chromosome 4 and suggested a regional localization to 4pl2-pl3. The present study reveals conflicting data concerning the genetic localization of the K88 loci controlling the expression of the receptors for the E. coli pilus antigens. One group has reported data suggesting a loose linkage between K88 and EAL, now mapped to chromosome 4, whereas two other groups have found linkage between K88 and the transferrin locus (TF), mapped to chromosome 13 by in situ hybridization.     

Carnitine transport by rat kidney cortex slices: stimulation by dibutyryl cyclic AMP+.

The transport of carnitine by rat kidney cortex slices against a concentration gradient has been demonstrated. Similarities to other transport systems included a linear period of uptake, as well as indications of saturability of the system with increasing concentrations of substrate. The transport of carnitine was inhibited by anoxia, and carbonyl cyanide-m-chloro-phenylhydroxazone (CCC1P), an uncoupler of oxidative phosphorylation. Carnitine uptake was stimulated approximately 50% when kidney slices were treated with dibutyryl cAMP.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

The ras oncogene and tumour metastasis: observations on murine cells transfected with activated human c-Ha-ras

Transfection of cells with cloned genes or total genomic DNA offers a means for studying aspects of neoplastic behaviour. We have used this method to examine whether incorporation of the cloned 6.6-kilobase (kb) fragment of DNA containing the mutant c-Ha-ras human oncogene can confer metastatic capability on murine NIH 3T3 cells. Cells co-transfected with the mutated ras gene and the neomycin resistance marker pSV2neo were selected by culture in neomycin. On subcutaneous inoculation into MF 1 nude mice, these cells proved to be tumourigenic with short latent periods (approximately 14 days)--nude mice were used to circumvent immunological rejection of the mouse cells expressing the product of the human oncogene. Transfectants were capable of lung colonisation after intravenous injection, but there was no evidence of spontaneous metastasis at autopsy, or on histological examination of the lungs and other organs, 90 days after inoculation. Incorporation of the transfected oncogene was confirmed by Southern blotting and its expression by dot-blot hybridisation and immunoprecipitation. The results in this experimental system indicate that transfection of a mutated human ras oncogene into non-neoplastic 3T3 cells can confer part of the metastatic phenotype, namely lung colonisation, but is not by itself sufficient to induce spontaneous metastatic behaviour.     

Reclustering of scattered Golgi elements occurs along microtubules

Depolymerization of the interphase microtubules by nocodazole results in the scattering and apparent fragmentation of the Golgi apparatus in Vero fibroblast cells. Upon removal of the drug, the interphase microtubules repolymerize, and the scattered Golgi elements move back to the region around the microtubule-organizing center (MTOC) within 40 to 60 min. Using a fluorescent lipid analogue (C6-NBD-ceramide) as a vital stain for the scattered Golgi elements, their relocation was visualized by video-enhanced fluorescence microscopy in Vero cells maintained at 20 degrees C. The NBD-labeled structures were identified as Golgi elements by their colocalization with galactosyltransferase in the fixed cells. During reclustering, NBD-labeled Golgi elements were observed to move by discontinuous saltations towards the MTOC with velocities of 0.1 to 0.4 micron/s. Paths along which Golgi elements moved were super-imposable on microtubules visualized by indirect immunofluorescence. Neither the collapse of intermediate filaments caused by microinjection of antibodies to vimentin nor the disruption of microfilaments by cytochalasin D had an effect on the reclustering of Golgi elements or the positioning of the Golgi apparatus. These data show that scattered Golgi elements move along microtubules back to the region around the MTOC, while neither intact intermediate filaments nor microfilaments are involved.