Different pituitary beta-endorphin and adrenal cortisol response to ethanol in individuals with high and low risk for future development of alcoholism

The purpose of the present studies was to investigate the activity of the adrenal gland and the pituitary beta-endorphin system in individuals from families with a 3 generation history of alcoholism, High Risk group, or from families without history of alcoholism, Low Risk group. All subjects had a medical examination, a drinking behavior personal interview and the Michigan Alcoholism Screening Test. Individuals with medical problems or excessive drinking were not included in the study. On the day of testing, a blood sample was taken at 9:00 a.m., then the subject drank a placebo drink or an ethanol solution (0.5 g ethanol/kg B.Wt.). Additional blood samples were taken at 15, 45 and 120 minutes post-drink. Results indicated that individuals of the High Risk group had lower basal levels of beta-endorphin like immunoreactivity (beta-EPLIR) than individuals of the Low Risk group. The dose of 0.5 g ethanol/kg B.Wt. induced an increase in the plasma content of beta-EPLIR of the High Risk group, but not of the Low Risk group. In the Low Risk group ethanol did not induce an increase above the 9:00 a.m. levels, however, it attenuated the beta-endorphin decrease overtime, observed following the placebo drink. Analysis of beta-endorphin-like peptides in the plasma of the High Risk group, with Sephadex G-75 chromatography indicated that the major component of the plasma beta-EPLIR was beta-lipotropin. Plasma cortisol levels, following ethanol intake, presented a small increase in the High Risk group but not in the Low Risk group. Both groups presented similar blood alcohol levels. The basal levels of immunoreactive cortisol and beta-endorphin in the plasma of individuals who were alcoholics, but had been abstinent for at least six months prior to testing were similar to the levels of the High Risk group. Thus there are differences both in the basal levels and in the response of the cortisol and the pituitary beta-endorphin system to an acute ethanol challenge between the two groups.     

Cardiomyocyte-specific perilipin 5 overexpression leads to myocardial steatosis and modest cardiac dysfunction

Presence of ectopic lipid droplets (LDs) in cardiac muscle is associated to lipotoxicity and tissue dysfunction. However, presence of LDs in heart is also observed in physiological conditions, such as when cellular energy needs and energy production from mitochondria fatty acid β-oxidation are high (fasting). This suggests that development of tissue lipotoxicity and dysfunction is not simply due to the presence of LDs in cardiac muscle but due at least in part to alterations in LD function. To examine the function of cardiac LDs, we obtained transgenic mice with heart-specific perilipin 5 (Plin5) overexpression (MHC-Plin5), a member of the perilipin protein family. Hearts from MHC-Plin5 mice expressed at least 4-fold higher levels of plin5 and exhibited a 3.5-fold increase in triglyceride content versus nontransgenic littermates. Chronic cardiac excess of LDs was found to result in mild heart dysfunction with decreased expression of peroxisome proliferator-activated receptor (PPAR)α target genes, decreased mitochondria function, and left ventricular concentric hypertrophia. Lack of more severe heart function complications may have been prevented by a strong increased expression of oxidative-induced genes via NF-E2-related factor 2 antioxidative pathway. Perilipin 5 regulates the formation and stabilization of cardiac LDs, and it promotes cardiac steatosis without major heart function impairment.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Minor groove binding DNA ligands with expanded A/T sequence length recognition, selective binding to bent DNA regions and enhanced fluorescent properties

DNA minor groove ligands provide a paradigm for double-stranded DNA recognition, where common structural motifs provide a crescent shape that matches the helix turn. Since minor groove ligands are useful in medicine, new ligands with improved binding properties based on the structural information about DNA-ligand complexes could be useful in developing new drugs. Here, two new synthetic analogues of AT specific Hoechst 33258 5-(4-methylpiperazin-1-yl)-2-[2'-(3,4-dimethoxyphenyl)-5'-benzimidazolyl] benzimidazole (DMA) and 5-(4-methylpiperazin-1-yl)-2-[2'[2'-(4-hydroxy-3-methoxyphenyl)-5' '-benzimidazolyl]-5'-benzimidazolyl] benzimidazole (TBZ) were evaluated for their DNA binding properties. Both analogues are bisubstituted on the phenyl ring. DMA contains two ortho positioned methoxy groups, and TBZ contains a phenolic group at C-4 and a methoxy group at C-3. Fluorescence yield upon DNA binding increased 100-fold for TBZ and 16-fold for DMA. Like the parent compound, the new ligands showed low affinity to GC-rich (K approximately 4 x 10(7) M(-1)) relative to AT-rich sequences (K approximately 5 x 10(8) M(-1)), and fluorescence lifetime and anisotropy studies suggest two distinct DNA-ligand complexes. Binding studies indicate expanded sequence recognition for TBZ (8-10 AT base pairs) and tighter binding (DeltaT(m) of 23 degrees C for d (GA(5)T(5)C). Finally, EMSA and equilibrium binding titration studies indicate that TBZ preferentially binds highly hydrated duplex domains with altered A-tract conformations d (GA(4)T(4)C)(2) (K= 3.55 x 10(9) M(-1)) and alters its structure over d (GT(4)A(4)C)(2) (K = 3.3 x 10(8) M(-1)) sequences. Altered DNA structure and higher fluorescence output for the bound fluorophore are consistent with adaptive binding and a constrained final complex. Therefore, the new ligands provide increased sequence and structure selective recognition and enhanced fluorescence upon minor groove binding, features that can be useful for further development as probes for chromatin structure stability.     

Inhibition of tobacco smoke-induced lung inflammation by a catalytic antioxidant

Cigarette smokers experience airway inflammation and epithelial damage, the mechanisms of which are unknown. One potential cause may be free radicals either in tobacco smoke or produced during persistent inflammation. Inflammation may also be a driving force to cause airway epithelium to undergo changes leading to squamous cell metaplasia. To test whether tobacco smoke-induced inflammation could be reduced by a catalytic antioxidant, manganese(III)meso-tetrakis(N,N'-diethyl-1,3-imidazolium-2-yl) porphyrin (AEOL 10150) was given by intratracheal instillation to rats exposed to filtered air or tobacco smoke. Exposure to tobacco smoke for 2 d or 8 weeks (6 h/d, 3 d/week) significantly increased the number of cells recovered by bronchoalveolar lavage (BAL). AEOL 10150 significantly decreased BAL cell number in tobacco smoke-treated rats. Significant reductions in neutrophils were noted at 2 d and macrophages at 8 weeks. Lymphocytes were significantly reduced by AEOL 10150 at both time points. Squamous cell metaplasia following 8 weeks of tobacco smoke exposure was 12% of the total airway epithelial area in animals exposed to tobacco smoke without AEOL 10150, compared with 2% in animals exposed to tobacco smoke, but treated with AEOL 10150 (p <.05). We conclude that a synthetic catalytic antioxidant decreased the adverse effects of exposure to tobacco smoke.     

Progesterone receptor as an indicator of sperm function

Expression of progesterone receptor (PR) localization on spermatozoa was determined in men with normal and abnormal spermiograms. Studies were also carried out to evaluate the potential of PR as a marker of sperm function. Progesterone receptor expression on spermatozoa from men with normozoospermia (n = 8), oligozoospermia (n = 7), asthenozoospermia (n = 8), oligoasthenozoospermia (n = 7), and teratozoospermia (n = 11) was analyzed using an immunocytochemical method with monoclonal antibodies against PR, and flow cytometry using a cell-impermeable fluorescein-tagged progesterone coupled to BSA complex (P-FITC-BSA). Both methods revealed significantly fewer (P < 0.05) PR-positive spermatozoa in men with oligozoospermia, asthenozoospermia, oligoasthenozoospermia, and teratozoospermia compared with men with normozoospermia, thereby suggesting that down-regulation of PR expression in spermatozoa may be one of the causes of male infertility. Spermatozoa from men with normozoospermia (n = 12), oligozoospermia (n = 12), asthenozoospermia (n = 12), oligoasthenozoospermia (n = 9), and teratozoospermia (n = 10) were exposed to low osmotic conditions in the hypoosmotic swelling (HOS) test and then analyzed for PR expression using P-FITC-BSA complex. A significantly higher percentage (P < 0.05) of spermatozoa with physiologically active plasma membrane (HOS+) lacked PR expression (HOS+PR-) in all categories of men with infertility, thereby suggesting that compared to the HOS test, PR expression is a better indicator of sperm function. Furthermore, PR expression in spermatozoa showed a strong (P < 0.05) positive correlation with their ability to undergo an in vitro acrosome reaction. This was observed in all study groups (i.e., normozoospermia, r = 0.8545; oligozoospermia, r = 0.8711; asthenozoospermia, r = 0.7645; oligoasthenozoospermia, r = 0.9003; and teratozoospermia, r = 0.8676). This suggests a potential role for PR in the events leading to the acrosome reaction in sperm.     

Effect of chromium picolinate on histopathological alterations in STZ and neonatal STZ diabetic rats

Earlier studies from our laboratory have indicated insulin sensitizing action of chromium picolinate as the mechanism of its anti-diabetic activity in experimental models of type I and type II diabetes. In the present investigation, we have evaluated the effects of chronic administration of chromium picolinate on the functional and histological alterations of streptozotocin (STZ)-induced diabetes in rats. Type I diabetes was induced by intravenous injection of STZ (40 mg/kg) in adult rats, whereas, type II diabetes was induced by intraperitoneal injection of STZ (90 mg/kg) in 2-day old rat pups which in adulthood develop abnormalities resembling type II diabetes. Chromium picolinate was administered at 8 μg/ml in drinking water for 6 weeks and was found to improve glucose tolerance and increase insulin sensitivity of STZ-diabetic rats. This treatment decrease elevated serum creatinine and urea levels as well as elevated serum levels of hepatic enzymes of both groups of diabetic rats. Histopathological studies of kidney and liver show decrease in the intensity and incidence of vacuolations, cellular infiltration and hypertrophy of STZ and nSTZ (neonatal STZ) diabetic rats. Chronic treatment with chromium picolinate however, did not alter the normal function or morphology of control rats. Chronic chromium picolinate at the therapeutic doses that improved glucose tolerance, was observed to have no hepatotoxic or nephrotoxic potential. It was rather found to improve renal and hepatic function and to reduce abnormalities associated with STZ-diabetes. Chromium picolinate could play an important role in the long term management of diabetes mellitus.     

The Disulfide Bonds in Glycoprotein E2 of Hepatitis C Virus Reveal the Tertiary Organization of the Molecule

Hepatitis C virus (HCV), a major cause of chronic liver disease in humans, is the focus of intense research efforts worldwide. Yet structural data on the viral envelope glycoproteins E1 and E2 are scarce, in spite of their essential role in the viral life cycle. To obtain more information, we developed an efficient production system of recombinant E2 ectodomain (E2e), truncated immediately upstream its trans-membrane (TM) region, using Drosophila melanogaster cells. This system yields a majority of monomeric protein, which can be readily separated chromatographically from contaminating disulfide-linked aggregates. The isolated monomeric E2e reacts with a number of conformation-sensitive monoclonal antibodies, binds the soluble CD81 large external loop and efficiently inhibits infection of Huh7.5 cells by infectious HCV particles (HCVcc) in a dose-dependent manner, suggesting that it adopts a native conformation. These properties of E2e led us to experimentally determine the connectivity of its 9 disulfide bonds, which are strictly conserved across HCV genotypes. Furthermore, circular dichroism combined with infrared spectroscopy analyses revealed the secondary structure contents of E2e, indicating in particular about 28% β-sheet, in agreement with the consensus secondary structure predictions. The disulfide connectivity pattern, together with data on the CD81 binding site and reported E2 deletion mutants, enabled the threading of the E2e polypeptide chain onto the structural template of class II fusion proteins of related flavi- and alphaviruses. The resulting model of the tertiary organization of E2 gives key information on the antigenicity determinants of the virus, maps the receptor binding site to the interface of domains I and III, and provides insight into the nature of a putative fusogenic conformational change.