Malnutrition and child mortality: are socioeconomic factors important?

The influences of household economic condition, maternal education, sex, and nutritional status of children on mortality were examined using multivariate analytical techniques. Weights of around 1700 children aged 2 60 months in five villages of Matlab, Bangladesh, were taken during the first half of 1981. The children were followed for 18 months and their survival was recorded. The severely malnourished children had a risk of death nine times that of their counterparts with better nutritional status. Female children had a higher risk of death than the males. Mother's education and economic condition of household also showed negative relationships with the risk of death, but the effect of mother's education was modified by economic condition and sex of the children.     

Salt Intake and Health Risk in Climate Change Vulnerable Coastal Bangladesh: What Role Do Beliefs and Practices Play?

BackgroundHigh salt consumption is an important risk factor of elevated blood pressure. In Bangladesh about 20 million people are at high risk of hypertension due to climate change induced saline intrusion in water. The objective of this study is to assess beliefs, perceptions, and practices associated with salt consumption in coastal Bangladesh.MethodsThe study was conducted in Chakaria, Bangladesh between April-June 2011. It was a cross sectional mixed method study. For the qualitative study 6 focus group discussions, 8 key informant interviews, 60 free listing exercises, 20 ranking exercises and 10 observations were conducted. 400 adults were randomly selected for quantitative survey. For analysis we used SPSS for quantitative data, and Anthropac and Nvivo for qualitative data.ResultsSalt was described as an essential component of food with strong cultural and religious roots. People described both health benefits and risks related to salt intake. The overall risk perception regarding excessive salt consumption was low and respondents believed that the cooking process can render the salt harmless. Respondents were aware that salt is added in many foods even if they do not taste salty but did not recognize that salt can occur naturally in both foods and water.ConclusionsIn the study community people had low awareness of the risks associated with excess salt consumption and salt reduction strategies were not high in their agenda. The easy access to and low cost of salt as well as unrecognised presence of salt in drinking water has created an environment conducive to excess salt consumption. It is important to design general messages related to salt reduction and test tailored strategies especially for those at high risk of hypertension.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Glutamate dehydrogenase from the aerobic hyperthermophilic archaeon Aeropyrum pernix K1: enzymatic characterization, identification of the encoding gene, and phylogenetic implications

NADP-dependent glutamate dehydrogenase (l-glutamate: NADP oxidoreductase, deaminating, EC 1.4.1.4) from the aerobic hyperthermophilic archaeon Aeropyrum pernix K1 (JCM 9820) was purified to homogeneity for characterization. The enzyme retained its full activity on heating at 95°C for 30 min, and the maximum activity in l-glutamate deamination was obtained around 100°C. The enzyme showed a strict specificity for l-glutamate and NADP on oxidative deamination and for 2-oxoglutarate and NADPH on reductive amination. The K _m values for NADP, l-glutamate, NADPH, 2-oxoglutarate, and ammonia were 0.039, 3.3, 0.022, 1.7, and 83 mM, respectively. On the basis of the N-terminal amino acid sequence, the encoding gene was identified in the A. pernix K1 genome, cloned, and expressed in Escherichia coli. Analysis of the nucleotide sequence revealed an open reading frame of 1257 bp starting with a minor TTG codon and encoding a protein of 418 amino acids with a molecular weight of 46 170. Phylogenetic analysis revealed that the glutamate dehydrogenase from A. pernix K1 clustered with those from aerobic Sulfolobus solfataricus, Sulfolobus shibatae, and anaerobic Pyrobaculum islandicum in Crenarchaeota, and it separated from another cluster of the enzyme from Thermococcales in Euryarchaeota. The branching pattern of the enzymes from A. pernix K1, S. solfataricus, S. shibatae, and Pb. islandicum in the phylogenetic tree coincided with that of 16S rDNAs obtained from the same organisms. Received: April 24, 2000 / Accepted: August 10, 2000     

Engineering a Monolignol 4-O-Methyltransferase with High Selectivity for the Condensed Lignin Precursor Coniferyl Alcohol

Lignin, a rigid biopolymer in plant cell walls, is derived from the oxidative polymerization of three monolignols. The composition of monolignol monomers dictates the degree of lignin condensation, reactivity, and thus the degradability of plant cell walls. Guaiacyl lignin is regarded as the condensed structural unit. Polymerization of lignin is initiated through the deprotonation of the para-hydroxyl group of monolignols. Therefore, preferentially modifying the para-hydroxyl of a specific monolignol to deprive its dehydrogenation propensity would disturb the formation of particular lignin subunits. Here, we test the hypothesis that specific remodeling the active site of a monolignol 4-O-methyltransferase would create an enzyme that specifically methylates the condensed guaiacyl lignin precursor coniferyl alcohol. Combining crystal structural information with combinatorial active site saturation mutagenesis and starting with the engineered promiscuous enzyme, MOMT5 (T133L/E165I/F175I/F166W/H169F), we incrementally remodeled its substrate binding pocket by the addition of four substitutions, i.e. M26H, S30R, V33S, and T319M, yielding a mutant enzyme capable of discriminately etherifying the para-hydroxyl of coniferyl alcohol even in the presence of excess sinapyl alcohol. The engineered enzyme variant has a substantially reduced substrate binding pocket that imposes a clear steric hindrance thereby excluding bulkier lignin precursors. The resulting enzyme variant represents an excellent candidate for modulating lignin composition and/or structure in planta.     

The first crystal structure of hyperthermostable NAD-dependent glutamate dehydrogenase from Pyrobaculum islandicum

The extremely thermostable NAD-dependent glutamate dehydrogenase (NAD-GluDH) from Pyrobaculum islandicum, a member of the Crenarchaeota, was crystallized, and its 3D structure has been determined by X-ray diffraction methods. The homohexameric structure of Pb. islandicum glutamate dehydrogenase (Pis-GluDH) was solved and refined at a resolution of 2.9A with a crystallographic R-factor of 19.9% (Rfree 26.0%). The structure indicates that each subunit consists of two domains separated by a deep cleft containing an active site. The secondary structural elements and catalytically important residues of the enzyme were highly conserved among the NAD(P)-dependent GluDHs from other sources. A structural comparison of Pis-GluDH with other NAD(P)-dependent GluDHs suggests that a significant difference in the alpha8-loop-alpha9 region of this enzyme is associated with its coenzyme specificity. From the analysis of the 3D structure, hydrophobic interactions between intersubunits were found to be important features for the enzyme oligomerization. It has been reported that Pis-GluDH is highly thermostable, like the GluDH of the hyperthermophilic archaeum Pyrococcus furiosus, and the increase in the intersubunit ion pair networks is responsible for the extreme thermostability of the Pc. furiosus enzyme. However, the number of intersubunit ion pairs in the Pis-GluDH molecules is much smaller than those of the Pc. furiosus GluDH. The number of hydrophobic interactions at the intersubunit interfaces were increased and responsible for the extremely high thermostability. This indicates that the major molecular strategy for high thermostability of the GluDHs may be different for each hyperthermophile.     

Fine needle aspiration of pulmonary adiaspiromycosis: a case report

BACKGROUND: Pulmonary adiaspiromycosis is a common disease of many species of wild rodents and occasionally of humans, caused by the inhalation of spores of the fungus Chrysosporium parvum var crescens (Emmonsia crescens). CASE: A 74-year-old female with pulmonary adiaspiromycosis was diagnosed by radiologically guided lung fine needle aspiration (FNA). The specimen showed intracellular and extracellular 100-300 microm conidia with a distinct thick, trilaminar wall, which was positive for Gomori-methenamine silver and periodic acid-Schiff stain. The background consisted of a granulomatous process. CONCLUSION: FNA is an effective method of diagnosing pulmonary adiaspiromycosis, and pathologists need to be aware of the characteristic features of this unusual opportunistic fungal infection.     

Metabolic Engineering of Saccharomyces cerevisiae for Caffeine and Theobromine Production

Caffeine (1, 3, 7-trimethylxanthine) and theobromine (3, 7-dimethylxanthine) are the major purine alkaloids in plants, e.g. tea (Camellia sinensis) and coffee (Coffea arabica). Caffeine is a major component of coffee and is used widely in food and beverage industries. Most of the enzymes involved in the caffeine biosynthetic pathway have been reported previously. Here, we demonstrated the biosynthesis of caffeine (0.38 mg/L) by co-expression of Coffea arabica xanthosine methyltransferase (CaXMT) and Camellia sinensis caffeine synthase (TCS) in Saccharomyces cerevisiae. Furthermore, we endeavored to develop this production platform for making other purine-based alkaloids. To increase the catalytic activity of TCS in an effort to increase theobromine production, we identified four amino acid residues based on structural analyses of 3D-model of TCS. Two TCS1 mutants (Val317Met and Phe217Trp) slightly increased in theobromine accumulation and simultaneously decreased in caffeine production. The application and further optimization of this biosynthetic platform are discussed.     

Conversion of DDT to DDD in flooded soil

Summary Anaerobic conditions obtained by flooding the soil caused reductive dechlorination of p,p-DDT and its conversion to p,p-DDD was enhanced under water-logged conditions creating or favouring anaerobiosis. The DDT showed recalcitrance in the soil kept at 15% moisture.More o,p-DDT was lost from the flooded soil. Similar amounts of p,p-DDE were detected in all of the three levels of technical DDT treatments and the concentrations were not significantly different under both aerobic and anaerobic conditions.     

Engineering Monolignol 4-O-Methyltransferases to Modulate Lignin Biosynthesis

Lignin is a complex polymer derived from the oxidative coupling of three classical monolignols. Lignin precursors are methylated exclusively at the meta-positions (i.e. 3/5-OH) of their phenyl rings by native O-methyltransferases, and are precluded from substitution of the para-hydroxyl (4-OH) position. Ostensibly, the para-hydroxyls of phenolics are critically important for oxidative coupling of phenoxy radicals to form polymers. Therefore, creating a 4-O-methyltransferase to substitute the para-hydroxyl of monolignols might well interfere with the synthesis of lignin. The phylogeny of plant phenolic O-methyltransferases points to the existence of a batch of evolutionarily “plastic” amino acid residues. Following one amino acid at a time path of directed evolution, and using the strategy of structure-based iterative site-saturation mutagenesis, we created a novel monolignol 4-O-methyltransferase from the enzyme responsible for methylating phenylpropenes. We show that two plastic residues in the active site of the parental enzyme are vital in dominating substrate discrimination. Mutations at either one of these separate the evolutionarily tightly linked properties of substrate specificity and regioselective methylation of native O-methyltransferase, thereby conferring the ability for para-methylation of the lignin monomeric precursors, primarily monolignols. Beneficial mutations at both sites have an additive effect. By further optimizing enzyme activity, we generated a triple mutant variant that may structurally constitute a novel phenolic substrate binding pocket, leading to its high binding affinity and catalytic efficiency on monolignols. The 4-O-methoxylation of monolignol efficiently impairs oxidative radical coupling in vitro, highlighting the potential for applying this novel enzyme in managing lignin polymerization in planta.