Stabilization of Z-RNA by chemical bromination and its recognition by anti-Z-DNA antibodies

Limited chemical bromination of poly[r(C-G)] (32% br8G, 26% br5C) results in partial modification of guanine C8 and cytosine C5, producing a mixture of A- and Z-RNA forms. The Z conformation in the brominated polynucleotide is stabilized at much lower ionic strength than in the unmodified polynucleotide. More extensive bromination of poly[r(C-G)] (greater than 49% br8G, 43% br5C) results in stabilization of a form of RNA having a Z-DNA-like (ZD) CD spectrum in low-salt, pH 7.0-7.5 buffers. Raising the ionic strength to 6 M NaBr or NaClO4 results in a transition in Br-poly[r(C-G)] to a Z-RNA (ZR) conformation as judged by CD spectroscopy. At lower ionic strength Z-DNA-like (ZD) and A-RNA conformations are also present. 1H NMR data demonstrate a 1/1 mixture of A- and Z-RNAs in 110 mM NaBr buffer at 37 degrees C. Nuclear Overhauser effect (NOE) experiments permit complete assignments of GH8, CH6, CH5, GH1', and CH1' resonances in both the A- and Z-forms. GH8----GH1' NOEs demonstrate the presence of both A- and Z-form GH8 resonances in slow exchange on the NMR time scale. The NMR results indicate that unbrominated guanine residues undergo transition to the syn conformation (Z-form). Raman scattering data are consistent with a mixture of A- and Z-RNAs in 110 mM NaCl buffer at 37 degrees C. Comparison with the spectrum of Z-DNA indicates that there may be different glycosidic torsion angles in Z-RNA and Z-DNA [Tinoco, I., Jr., Cruz, P., Davis, P., Hall, K., Hardin, C. C., Mathies, R. A., Puglisi, J. D., Trulson, M. O., Johnson, W. C., & Neilson, T. (1986) in Structure and Dynamics of RNA, pp 55-68, Plenum, New York].(ABSTRACT TRUNCATED AT 250 WORDS)     

Chromosome abnormalities in tuberous sclerosis

Summary In fibroblasts cultured from biopsies of the skin lesions of six patients with tuberous sclerosis (TS) there was a variable but consistent degree of karyotypic variation. Premature centromere disjunction (PCD) of all or part of the chromosomes, micronuclei, an increased incidence of breaks, dicentric chromosomes and the presence of polyploid metaphases were found in all cultures. The PCD was of the type encountered in Roberts syndrome and its frequency varied from 8% to 30%. In metaphases with PCD of one and of two chromosomes, the chromosome involved were identified, and chromosome 3 was involved 21 times among 59 chromosomes with PCD. Chromosome 3 tends to be preferentially involved in dicentric formation. In lymphocyte cultures from the same patients there were no metaphases with PCD, but there was a slight increase of breaks and the presence of dicentric chromosomes, also involving chromosome 3. Polyploid metaphases were increased in some of the cases. Karyotypic variation can be considered a cellular phenotypic characteristic of TS in fibroblasts cultured from the skin lesions, and its type indicates disturbances in the mechanics of centromere division and of chromosome distribution at cell division.     

Effects of nitrogen deprivation on the ATP-sulphurylase and O-acetylserine sulphydrylase activities of mesophyll protoplasts and bundle sheath strands of maize leaves

In maize leaves nitrogen (N)-deprivation induced a significant decline of chlorophyl and total N contents. On the contrary, sulphur (S) content increased with N-deprivation. The activities of ATP-sulphurylase and O-acetylserine sulphydrylase also decreased with N-deprivation, but ATP-sulphurylase activity was more sensitive than O-acetylserine sulphydrylase activity to N-deficiency both in whole leaf extracts and in isolated leaf cells. Finally, N-deprivation induced higher changes in activity of the two enzymes in mesophyll protoplasts than in bundle sheath strands. This research was supported by Consiglio Nazionale delle Ricerche-Special grant I.P.R.A.-Subproject 1. Paper N. 73.     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

Effects of different levels of dietary zinc on the gilthead,Sparus aurata during the growing season

Gilthead were fed three diets. Diet A was the control diet, whereas diets B and C were supplemented with 300 and 900 mg Zn/kg, respectively. Fish fed with diet C, at the end of the experiment, showed the lowest weight. Zinc concentrations presented the higher values in gills, liver, and kidney. Muscle and brain had the lower mean values and showed a tight control of zinc levels. These results reinforce the hypothesis that zinc in the CNS should be strictly controlled in order to maintain the functional role of the metal. Significant differences in tissue zinc concentrations were obtained between fish fed different amounts of zinc, the metal concentrations being higher in tissues of fish fed diet C. The tissue decrease of zinc, found at the end of the experiment, may depend on a lower feed consumption or on different zinc requirements during the cold season. These changes, even if not univocal among the three diets, may be associated with the life cycle of fish. Furthermore, copper concentrations were little affected by the different concentrations of zinc in the three diets; liver and kidney presented the highest concentrations; liver showed a significant decrease in copper content at the end of the experiment. We conclude that: zinc concentrations of the diet may affect the gilthead weights and the tissual metal content; and zinc concentrations in the diets, depending on the growth rate, may be varied depending on the season.     

Efficient direct chromosome analyses and enzyme determinations from chorionic villi samples in the first trimester of pregnancy

Chorionic villi were obtained by an aspiration technique which proved to be the best of four alternative procedures. We report in detail the series of experiments which led to (1) successful, rapidly growing cell cultures practically free of maternal cell contamination (the use of hormone-supplemented Chang medium greatly increased the growth rate); (2) an efficient direct method to obtain high quality metaphases from the Langhans cells of the cytotrophoblast tissue and with which the fetal karyotype is defined within a few hours of chorionic villi sampling; and (3) successful testing for the activity of eight enzymes directly from the villi samples, thus showing that this material is suitable for a rapid, direct diagnosis of the related metabolic diseases.     

Allelism of IMP1 and GAL2 genes of Saccharomyces cerevisiae.

Cloning and characterization of the previously described Saccharomyces cerevisiae IMP1 gene, which was assumed to be a nuclear determinant involved in the nucleomitochondrial control of the utilization of galactose, demonstrate allelism to the GAL2 gene. Galactose metabolism does not necessarily involve the induction of the specific transport system coded by GAL2/IMP1, because a null mutant takes up galactose and grows on it. Data on galactose uptake are presented, and the dependence on ATP for constitutive and inducible galactose transport is discussed. These results can account for the inability of imp1/gal2 mutants to grow on galactose in a respiration-deficient background. Under these conditions, uptake was affected at the functional level but not at the biosynthetic level.